ID: 1160463428

View in Genome Browser
Species Human (GRCh38)
Location 18:79056448-79056470
Sequence CCTCAGGAGGACCTGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160463421_1160463428 0 Left 1160463421 18:79056425-79056447 CCTGGGCTCAAAGGATCCCTCTG No data
Right 1160463428 18:79056448-79056470 CCTCAGGAGGACCTGTAGCTGGG No data
1160463418_1160463428 9 Left 1160463418 18:79056416-79056438 CCTCCAACTCCTGGGCTCAAAGG 0: 10
1: 202
2: 2202
3: 12388
4: 46957
Right 1160463428 18:79056448-79056470 CCTCAGGAGGACCTGTAGCTGGG No data
1160463420_1160463428 6 Left 1160463420 18:79056419-79056441 CCAACTCCTGGGCTCAAAGGATC No data
Right 1160463428 18:79056448-79056470 CCTCAGGAGGACCTGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160463428 Original CRISPR CCTCAGGAGGACCTGTAGCT GGG Intergenic
No off target data available for this crispr