ID: 1160464424

View in Genome Browser
Species Human (GRCh38)
Location 18:79064433-79064455
Sequence TGGAGTAGATGCAGGCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160464424_1160464432 26 Left 1160464424 18:79064433-79064455 CCAGCTGGCCTGCATCTACTCCA No data
Right 1160464432 18:79064482-79064504 TGCTCCCAGGGCTCCAACTCAGG No data
1160464424_1160464430 14 Left 1160464424 18:79064433-79064455 CCAGCTGGCCTGCATCTACTCCA No data
Right 1160464430 18:79064470-79064492 TTGAGGTAGCCTTGCTCCCAGGG No data
1160464424_1160464429 13 Left 1160464424 18:79064433-79064455 CCAGCTGGCCTGCATCTACTCCA No data
Right 1160464429 18:79064469-79064491 TTTGAGGTAGCCTTGCTCCCAGG No data
1160464424_1160464427 -3 Left 1160464424 18:79064433-79064455 CCAGCTGGCCTGCATCTACTCCA No data
Right 1160464427 18:79064453-79064475 CCATAGCCTCATGCTCTTTGAGG No data
1160464424_1160464434 30 Left 1160464424 18:79064433-79064455 CCAGCTGGCCTGCATCTACTCCA No data
Right 1160464434 18:79064486-79064508 CCCAGGGCTCCAACTCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160464424 Original CRISPR TGGAGTAGATGCAGGCCAGC TGG (reversed) Intergenic
No off target data available for this crispr