ID: 1160465147

View in Genome Browser
Species Human (GRCh38)
Location 18:79069699-79069721
Sequence CTGCCCGCGGCCCTCACCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 214}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160465147_1160465154 5 Left 1160465147 18:79069699-79069721 CCGGTGGTGAGGGCCGCGGGCAG 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1160465154 18:79069727-79069749 GGGGCGAGCGGCTGCATCCCCGG 0: 1
1: 0
2: 1
3: 8
4: 160
1160465147_1160465155 6 Left 1160465147 18:79069699-79069721 CCGGTGGTGAGGGCCGCGGGCAG 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1160465155 18:79069728-79069750 GGGCGAGCGGCTGCATCCCCGGG 0: 1
1: 0
2: 0
3: 19
4: 147
1160465147_1160465157 15 Left 1160465147 18:79069699-79069721 CCGGTGGTGAGGGCCGCGGGCAG 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1160465157 18:79069737-79069759 GCTGCATCCCCGGGACGCCTGGG 0: 1
1: 0
2: 4
3: 10
4: 123
1160465147_1160465161 26 Left 1160465147 18:79069699-79069721 CCGGTGGTGAGGGCCGCGGGCAG 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1160465161 18:79069748-79069770 GGGACGCCTGGGCCGAGCGTAGG 0: 1
1: 0
2: 0
3: 12
4: 104
1160465147_1160465156 14 Left 1160465147 18:79069699-79069721 CCGGTGGTGAGGGCCGCGGGCAG 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1160465156 18:79069736-79069758 GGCTGCATCCCCGGGACGCCTGG 0: 1
1: 0
2: 3
3: 213
4: 9139
1160465147_1160465152 -7 Left 1160465147 18:79069699-79069721 CCGGTGGTGAGGGCCGCGGGCAG 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1160465152 18:79069715-79069737 CGGGCAGCTGCCGGGGCGAGCGG 0: 1
1: 0
2: 6
3: 292
4: 1332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160465147 Original CRISPR CTGCCCGCGGCCCTCACCAC CGG (reversed) Intronic
900402392 1:2477915-2477937 CTGCCCCCGCCCCTGGCCACAGG - Intronic
900418099 1:2544167-2544189 GTGCCCACAGCCCTCCCCACTGG - Intergenic
901064108 1:6486487-6486509 CTGCCCACGGCCCTTTCCAGAGG - Intronic
901308493 1:8250754-8250776 CTGGCCGTGCCCCTCCCCACGGG - Intergenic
901793073 1:11664519-11664541 CCGCCCGCGCCCCCCACCCCTGG - Intronic
902318209 1:15639930-15639952 CTGACCTCTGCCGTCACCACAGG - Intronic
903300741 1:22376904-22376926 CTTCCTGAGGCCCTCACCAAAGG + Intergenic
904081040 1:27872697-27872719 CTGCCCCCGCCCCACACCAAGGG - Intronic
905584452 1:39105735-39105757 CGGCCCGCGGGCCTCAGCGCCGG - Intronic
905693747 1:39960434-39960456 CTGCCCCCGGCCCTGAAGACTGG - Intronic
905734672 1:40316987-40317009 CTGCCCGCGGCGCTGTCCTCAGG + Intronic
907050918 1:51329713-51329735 CTGCCCCCTGCCCTGCCCACTGG + Intronic
907115730 1:51966858-51966880 CTGCCCGCTGATCTCTCCACAGG + Intronic
907959782 1:59268131-59268153 CTTCCTGGGGCCCTCATCACAGG - Intergenic
908299916 1:62753533-62753555 CTGCCCGGGGCCAGCAGCACTGG - Intergenic
914200011 1:145476121-145476143 CTGCCCGTTGCCCTCCCCGCGGG - Intergenic
914899435 1:151704023-151704045 CTGCCCCCGGCCCTGACCTTGGG + Intronic
914908161 1:151763448-151763470 CTGCCCGGGGCCGTGACAACGGG + Exonic
916462555 1:165041984-165042006 CTGGCCTCAGCCCTCCCCACTGG + Intergenic
917712858 1:177704830-177704852 CTGCCTGTGGCCCCCACCAGAGG + Intergenic
922548647 1:226477489-226477511 CTGCCTCCTGCCCTCACCCCAGG - Intergenic
1063130293 10:3172459-3172481 CTGCCCGCGGCGCTCCCGGCGGG - Intronic
1063216771 10:3932384-3932406 CTGCCCCCAGCCCTTGCCACAGG - Intergenic
1063329869 10:5147059-5147081 CAGCCTGGGGCCCTCACCAGAGG - Intergenic
1064348589 10:14556098-14556120 CTGCCTGGGGCCCTCAGGACTGG + Intronic
1067038728 10:42937026-42937048 GTGCACCCTGCCCTCACCACGGG - Intergenic
1067468834 10:46521826-46521848 CAGCCTGAGGCCCTCACCAGAGG - Intergenic
1069438482 10:68407123-68407145 CTGGCCGCGGCCCTCAGCCCGGG + Exonic
1069683071 10:70299136-70299158 CTGCCCCAGGTCCTCACCTCAGG - Exonic
1069688579 10:70334941-70334963 CTGCCCCTTACCCTCACCACAGG - Intronic
1070159981 10:73860486-73860508 CTGCCAGCGTCCCTCACCAGGGG - Intronic
1070577792 10:77692896-77692918 CTGCATGCAGCCCTCAACACAGG + Intergenic
1070627269 10:78060264-78060286 CTGCCCTACTCCCTCACCACGGG - Intergenic
1070801874 10:79248641-79248663 CTGCCCTCGCCCCCCACCATGGG - Intronic
1071679331 10:87689042-87689064 CTGGCCCCGGCCCTGACCCCTGG - Intronic
1072227908 10:93387249-93387271 CTGCCCGCGGCCCTCCTTGCTGG - Intronic
1073196775 10:101697699-101697721 CTGCCCCCGGCCCTCATTAATGG + Intergenic
1074591278 10:114816147-114816169 CTGCCCCCTGCCCCCACCACAGG - Intergenic
1075052694 10:119194627-119194649 CTGCCTGCAGCCCTCAGCAATGG + Intergenic
1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG + Intergenic
1076561127 10:131364951-131364973 CTGCCCATGGTTCTCACCACAGG + Intergenic
1076826751 10:132973270-132973292 CTGCCCCCCGTCCTCCCCACAGG - Intergenic
1077060029 11:613950-613972 CAGCCCGCGGCACTAACGACAGG - Exonic
1079121545 11:17688586-17688608 CTGCCCCAGCCCCTCAACACAGG - Intergenic
1079351037 11:19692187-19692209 CTGGCTGAGGGCCTCACCACCGG + Intronic
1080515429 11:33015694-33015716 CGGCCCGCGGCTCACACCAGCGG - Intergenic
1081831530 11:46120015-46120037 CTGCCTGCACCCCTCACCCCGGG - Intronic
1083619312 11:64041085-64041107 CTGCCCGCGTCACTCTCCAGAGG + Intronic
1083777582 11:64901842-64901864 CTGCCTGCTTCTCTCACCACGGG + Intronic
1083924123 11:65795706-65795728 CTGCCCCCGCCTCTCAGCACAGG + Exonic
1084325476 11:68397450-68397472 CTGCCCCCGGCCCTCTCCCCTGG + Intronic
1084572425 11:69967714-69967736 CTGCCCGAGGGCCACACAACTGG + Intergenic
1084603943 11:70161989-70162011 CTGCCCAGGGCCCTCACTCCCGG - Intronic
1084603971 11:70162065-70162087 CTGCCCGGGGCCCTCACTGCCGG - Intronic
1084603983 11:70162095-70162117 CTGCCCGGGGCCCTCACTCCCGG - Intronic
1084604002 11:70162157-70162179 CTGCCCAAGGCCCTCACTCCCGG - Intronic
1084604034 11:70162249-70162271 CTGTCCGGGGCCCTCACTCCCGG - Intronic
1084943141 11:72625094-72625116 CTGCCAGGGGCCCTGACAACAGG - Intronic
1089681082 11:120119335-120119357 CAGCCCCCAGCCCTCCCCACAGG - Intronic
1090357485 11:126149844-126149866 CTGCCAGCACCCCTCATCACAGG + Intergenic
1090714668 11:129419734-129419756 CTTCCTGAGGCCCTCACCACAGG + Intronic
1091744527 12:2982617-2982639 CTGCCCGCGGCCCACATCCCGGG - Intronic
1095565294 12:43616180-43616202 GTGCCCACAGACCTCACCACTGG - Intergenic
1096245409 12:49982314-49982336 CTGGCCTCTTCCCTCACCACAGG - Intronic
1096749834 12:53751699-53751721 CGGCCCGCTGCCCTCGCCCCGGG - Intergenic
1104735094 12:131131635-131131657 CTGGCCACTGCCCTCACCACAGG - Intronic
1104746867 12:131216098-131216120 GTGCCCGCGGCACCCACGACTGG + Intergenic
1104785749 12:131447085-131447107 GTGCCCGCGGCACCCACGACTGG - Intergenic
1104824996 12:131701823-131701845 ACGCCCACAGCCCTCACCACCGG + Intergenic
1104927200 12:132319955-132319977 CGGCCAGCGGCCCCCACCGCTGG + Intronic
1107405524 13:40108988-40109010 CTGCAGGCTGCCCTCCCCACTGG + Intergenic
1108459109 13:50647353-50647375 CTGCCCTCCCCTCTCACCACAGG - Intronic
1110182665 13:72635961-72635983 CAGCCTGAGGCCCTCACCAAAGG + Intergenic
1114664557 14:24370034-24370056 CTCCCCGCTGCCCTCGCCCCGGG + Exonic
1115242116 14:31260110-31260132 CTGCCTGAGGCCCTCACCAGAGG + Intergenic
1118880318 14:69820032-69820054 CTGCCTACCGCCCTCCCCACTGG - Intergenic
1122227988 14:100290826-100290848 CCGCCAGTGCCCCTCACCACAGG + Intergenic
1123060689 14:105592857-105592879 ATGCCCCCGGCCCTCGCCAGGGG + Intergenic
1123085164 14:105713828-105713850 ATGCCCCCGGCCCTCGCCAGGGG + Intergenic
1128693133 15:69740390-69740412 CTACACGGGGCTCTCACCACTGG - Intergenic
1128999392 15:72319942-72319964 CTCCCCCTGGCCCTCGCCACCGG - Exonic
1129263294 15:74380952-74380974 CTGCCCCTGCCCCTCACCCCAGG + Intergenic
1129324981 15:74795044-74795066 CTTCCCGCTTCCCTCACCATCGG + Intronic
1129802706 15:78428258-78428280 GTGCCCCCAGCCCTTACCACAGG + Intergenic
1132695436 16:1199757-1199779 CTGCCCTCAGCCCTCACCCCTGG + Intronic
1132986551 16:2770433-2770455 CTCGCCCCAGCCCTCACCACGGG + Exonic
1133230072 16:4362235-4362257 CTGCCCACTCCCCTCACCCCAGG + Intronic
1133270544 16:4609086-4609108 CTGCCCGCCGCCCCCTCCCCAGG - Exonic
1136074463 16:27807293-27807315 CTGCACGCAGCTCTCCCCACAGG - Intronic
1137577874 16:49615554-49615576 CTGCCCTCTGCCCCCACCATGGG - Intronic
1138384797 16:56628843-56628865 CTTCCTGCGGCCCTCACCAGAGG + Intergenic
1138992204 16:62405059-62405081 CTGCCCACGCCCCTCACTCCTGG + Intergenic
1141147249 16:81539937-81539959 CTGCCCCCAGCCCTGAGCACTGG + Intronic
1141201428 16:81901217-81901239 CTGCCCGCCTCCCACACAACTGG - Intronic
1141480474 16:84303092-84303114 GTGCCCGGGGCCCTTAACACTGG - Intronic
1142176586 16:88648102-88648124 CTCCCCGCAGTCCTCATCACCGG - Exonic
1144584986 17:16482438-16482460 CTTCCCACGGCCCTCAGCCCAGG - Intronic
1144632604 17:16881740-16881762 CTGCCTCCTGCCCTCACCTCAGG + Intergenic
1146022587 17:29292806-29292828 CCGCCCCCGCCCCTCACCCCAGG + Intronic
1147896551 17:43755316-43755338 CCGCCCGCGCCCCTCCCCACCGG - Exonic
1148454923 17:47806073-47806095 CTCCCCGCTGCCCTCGCCCCTGG - Intergenic
1151262666 17:72929012-72929034 CTGCCCCTGGCCATCACCCCTGG - Intronic
1151429059 17:74050319-74050341 CTGCCCTCTGCCCTGTCCACGGG + Intergenic
1151842796 17:76629550-76629572 CAGCCCAAGGCCCACACCACCGG - Exonic
1152159443 17:78658285-78658307 CTAGCCTCGGCCCTCACCCCTGG - Intergenic
1152750437 17:82060093-82060115 CTGCCCGCTGCCCTCCCCTCAGG - Exonic
1158143254 18:54280237-54280259 CAGCCTGAGGCCCTCACCAGAGG - Intronic
1160465147 18:79069699-79069721 CTGCCCGCGGCCCTCACCACCGG - Intronic
1160760763 19:783014-783036 CCGGCCGCAGCCCTCACCAAAGG + Intergenic
1160764901 19:803203-803225 CTGCCAGCGGCCCTGGGCACAGG - Intronic
1161009526 19:1953633-1953655 CTGCCCGTGGCCCTCACCTGTGG + Intronic
1161488325 19:4547880-4547902 CTGCCCGCGGGCCTTTGCACGGG + Intronic
1162261621 19:9538850-9538872 CTGCCCGTAGCCCTGCCCACAGG - Intergenic
1162373281 19:10291295-10291317 CTGCGCGCGGCGCACACTACAGG + Exonic
1162555468 19:11383430-11383452 CTGTCCCCCGCCGTCACCACTGG + Intronic
1162588653 19:11576962-11576984 CTTCCCTCTGCCCTCACCAAAGG + Intronic
1162700008 19:12507373-12507395 CTGCGCCCGGCCCCCACCCCCGG + Intronic
1162792378 19:13069725-13069747 CTGCCCACTGCCAACACCACAGG - Intronic
1162863688 19:13527430-13527452 CAGCCTGAGGCCCTCACCAGAGG - Intronic
1163146213 19:15380430-15380452 GTGTCCGCGCCCCTCCCCACAGG - Exonic
1163566063 19:18052047-18052069 CTGGCCGTGGCCCCGACCACTGG + Intergenic
1163612402 19:18308287-18308309 CTTCACGCCACCCTCACCACAGG + Intronic
1164402447 19:27911304-27911326 CTGTCCGCAGCCCTCACCCCCGG + Intergenic
1164540093 19:29115601-29115623 CTGCCCCCTGCCCTCACTGCTGG + Intergenic
1164766900 19:30779175-30779197 CTGCCCGCTGCCCTCAGAGCCGG - Intergenic
1165427227 19:35752919-35752941 CTGCCCGCTTCCCCCACCAGCGG + Exonic
1165454003 19:35900425-35900447 CTGCCCGCGCCCATTACCTCGGG + Exonic
1167104136 19:47420412-47420434 CTGTCCACGCCCCCCACCACTGG - Intergenic
1167605720 19:50480500-50480522 CCTCCCCCGGCCCCCACCACAGG - Intronic
1168095083 19:54109914-54109936 CAGCCCCCGGCCCTCATCTCCGG + Intronic
1168267212 19:55229567-55229589 CTGCCCAAGGCCCTGCCCACAGG + Intergenic
929763717 2:44826798-44826820 CTCCCAGCGGCCCTCAGCACTGG - Intergenic
931696114 2:64871822-64871844 CAGCCCTCAGCCCTCACCAAAGG + Intergenic
932479179 2:72028447-72028469 CTGCCTCCGCCCCACACCACAGG + Intergenic
932664775 2:73687907-73687929 CTTCCTGAGGCCCTCACCAGAGG + Intergenic
934570071 2:95364752-95364774 CTTCCTGAGGCCCTCACCAGAGG + Intronic
934770860 2:96906971-96906993 CTGCCTGCTCCCCTCACCCCCGG - Intronic
937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG + Exonic
937445636 2:121955552-121955574 CTGGCCGCCTCCCTCCCCACGGG - Intergenic
938301133 2:130213729-130213751 CTGCCCGCTGCCCCCGCCACTGG + Intergenic
938338896 2:130522730-130522752 CGGCCCGTGGCCCTCCCCGCAGG - Intronic
938350942 2:130598020-130598042 CGGCCCGTGGCCCTCCCCGCAGG + Intronic
940237939 2:151530715-151530737 CAGCCCGCAGCCATCACCAATGG + Intronic
946314023 2:218897730-218897752 CTGCCCGCTGTCCCCACCCCTGG - Intronic
946325393 2:218982256-218982278 CTGACCGCCCCCCTCCCCACAGG - Exonic
948702414 2:239768579-239768601 CTGACCGTGACCCTCACCACAGG - Intronic
1169367302 20:5001601-5001623 CTGCCCTCGGGCCTCCCCCCGGG + Intronic
1171996501 20:31735807-31735829 CTGCCCCCGCCCCCCACCCCCGG + Intergenic
1174182551 20:48683943-48683965 ATGCCAGCGCCCCTCCCCACTGG - Intronic
1174194960 20:48766528-48766550 CTGCCCCCAGGCCTCAGCACAGG + Intronic
1175943875 20:62550029-62550051 CTGCCCGCCCCCCCCACCCCCGG + Intergenic
1178380158 21:32100892-32100914 CTGCCCGCTGCCTTCCCCAGTGG + Intergenic
1179892868 21:44345710-44345732 CTGACCGAGGACCTCCCCACCGG + Intergenic
1181116110 22:20633352-20633374 CTGCCCGTGGCCCTGGCCCCTGG + Intergenic
1181952893 22:26567284-26567306 CAGCCCCCTGCGCTCACCACTGG + Intronic
1182254754 22:29030603-29030625 CCGGCCGCGCCCCTCCCCACCGG - Intronic
1182259441 22:29062723-29062745 CTGCAGGCGGACCGCACCACAGG + Intergenic
1183315901 22:37136651-37136673 CTCCCCGCCGCACTCACCCCAGG + Intronic
1184421837 22:44386690-44386712 CAGCCCGCATCCCTCACCGCTGG + Intergenic
1184541008 22:45124754-45124776 CTGACCACGACTCTCACCACTGG + Intergenic
950167958 3:10815989-10816011 CTTCCCGCGGCCCTGCCCACTGG - Intergenic
955568532 3:60276732-60276754 CTCCCCAAGGCCCTCACCAGAGG - Intronic
961374671 3:126456350-126456372 GTGCCCGAGGCCTCCACCACAGG - Intronic
961442396 3:126960737-126960759 CTGCCTGCTGCCCTCACACCTGG - Intergenic
961950719 3:130746687-130746709 CTCCTCGAGGGCCTCACCACCGG + Exonic
962346060 3:134619739-134619761 CTGCCTTAGGGCCTCACCACAGG - Intronic
965407527 3:168288660-168288682 TTTCACGTGGCCCTCACCACTGG - Intergenic
966108220 3:176362481-176362503 CTGCCCGGGGCCCGCGCCGCCGG + Intergenic
967055521 3:185825696-185825718 CTGCCCTCGCCTCTCACCTCCGG - Intergenic
967197774 3:187043410-187043432 CTGCCCTGGGCCCACTCCACTGG - Intronic
967770754 3:193331226-193331248 CTGCCAGCTGCCCTGACCATAGG - Exonic
967920137 3:194608349-194608371 CTGGCAGGGGCCCTCACCACTGG + Intronic
969119815 4:4899885-4899907 CTGCCCGCAGCCCCCAGCCCTGG + Intergenic
969930657 4:10627808-10627830 CTGCCTGAGCCCCTCACCTCTGG + Intronic
979033198 4:115678583-115678605 ATGCCCGAGCCCCTCCCCACCGG - Intergenic
985223179 4:187730089-187730111 CTTCCTGCGGGCCTCACCAGAGG - Intergenic
985600284 5:825115-825137 CTGCACACGGCCCTGACCTCGGG + Intronic
986370499 5:7075461-7075483 CTGCCCCAGGCCCTCACTCCTGG + Intergenic
988634115 5:32963241-32963263 CTTCCTGAGGCCCTCACCAGGGG - Intergenic
992072149 5:73158106-73158128 CAGCCTGAGGCCCTCACCAGAGG - Intergenic
993110140 5:83646692-83646714 CTTCCCTCACCCCTCACCACAGG - Intronic
993621491 5:90173536-90173558 CTGCCCAGGGCACTCAGCACAGG + Intergenic
996619679 5:125484906-125484928 ATGCCTGTGGCCCTCGCCACAGG - Intergenic
997605396 5:135172387-135172409 CTGCCCACTGCCCCCACCTCAGG + Intronic
998278766 5:140784186-140784208 CTTCCAGAGGCCCTCACCAAAGG + Intergenic
999062882 5:148654372-148654394 CTGCCCGCTGCCGCCCCCACTGG + Intronic
1001937065 5:175712818-175712840 CTGATCTTGGCCCTCACCACCGG + Intergenic
1002579129 5:180197039-180197061 CTCCCCTCAGACCTCACCACAGG + Intronic
1004492521 6:16129625-16129647 CTGCGCCCGGCCCTCAGCGCTGG - Intronic
1004861387 6:19807225-19807247 CTGCCCGGGGCCGGCACCGCTGG + Intergenic
1005813079 6:29530929-29530951 CTGCCCCAGGCACCCACCACTGG - Intergenic
1006403518 6:33831281-33831303 CTGCCTGCGTCACTCTCCACAGG + Intergenic
1006593998 6:35179443-35179465 CTGCCCCCGACCCCAACCACGGG + Intergenic
1007383283 6:41504130-41504152 CTGCCCTCCGCCCTCACCCCCGG + Intergenic
1007636000 6:43300061-43300083 CTGCCTGCAGTCCTCACCAGAGG - Exonic
1007737884 6:43993227-43993249 CTGCCCCCTGCCCTCACCCTGGG + Intergenic
1009438603 6:63648060-63648082 CTGCCTGAGGACCTCAACACTGG + Intronic
1014099017 6:117489168-117489190 CTTCCTGAGGCCCTCACCAGAGG - Intronic
1018900083 6:168046898-168046920 CTGACAGCGCCCCTCAGCACAGG + Intergenic
1019277035 7:181319-181341 CTGCCCGCAGCCCCCATAACTGG + Intergenic
1019504329 7:1383288-1383310 CCGCCCTCGGCCCCCACCACCGG + Intergenic
1019518734 7:1451137-1451159 CTGGCCGGGGACCTCACCTCGGG - Intronic
1021817279 7:24460017-24460039 CTTCCTGGGGCCCTCACCAGAGG - Intergenic
1022974863 7:35547710-35547732 CTGCCGGCTTCCCTCTCCACAGG - Intergenic
1023938211 7:44754620-44754642 CTGACCGAGGGCCTCACCAATGG - Intronic
1027189149 7:75987862-75987884 CTGCCCCTGCCCCCCACCACGGG + Intronic
1027235564 7:76295622-76295644 CTGCACTCTGCCCTCCCCACTGG - Intergenic
1027674815 7:81143922-81143944 ATGCCCATGGCCATCACCACTGG - Intergenic
1028460274 7:91084644-91084666 CTGCCCTTGGCCATCACCAGGGG - Intronic
1029112976 7:98222973-98222995 CTGGCCCCGGCACTCACCGCAGG + Exonic
1029250436 7:99232621-99232643 CTGCCCACAGCCTTCACCGCTGG + Intergenic
1029640306 7:101816123-101816145 CCGCCCGCAGCCCCCACCCCCGG - Intronic
1031895912 7:127347772-127347794 CTCGCCGCGGCCGTCTCCACGGG - Intronic
1033062947 7:138125339-138125361 CTGCCCCAGGCCATCACCATTGG - Intergenic
1034501843 7:151455772-151455794 CTTCCTGAGGCCCTCACCAGAGG - Intergenic
1035242033 7:157538477-157538499 CTGCCCTCGGCTATCTCCACTGG - Intergenic
1035243530 7:157547763-157547785 CTGCCCCCTGCCCTGACCATGGG + Intronic
1044963907 8:97557017-97557039 CTGCCCGCGGCCAGCAGCGCTGG - Intergenic
1045407398 8:101880256-101880278 CTGCCCGGGGCCAGCAGCACTGG + Intronic
1047732034 8:127736084-127736106 CTGCTCGCGGCCGCCACCGCCGG + Exonic
1048484035 8:134831645-134831667 CTTCCCGCGGCCCCCACGCCCGG + Intergenic
1049218587 8:141418683-141418705 AGGCCCGCGGCCCACAGCACGGG - Intronic
1049708034 8:144051712-144051734 CAGGCCGCGGCCCTTACCCCGGG + Exonic
1051046889 9:12886581-12886603 CAGCCTGAGGCCCTCACCAGAGG - Intergenic
1051419058 9:16871802-16871824 AGGCCCGCGGCCCAGACCACGGG - Intergenic
1051913897 9:22185256-22185278 CTGCCCATGGCCCTCTCCATGGG + Intergenic
1053872623 9:42508408-42508430 CTGCCTGCTGCTGTCACCACAGG - Intergenic
1057052483 9:91936052-91936074 CTGGCCCCGGCCCTCAGCGCTGG - Intronic
1057909199 9:99004980-99005002 CTCCCCGGGGGCCACACCACTGG - Exonic
1060265311 9:122108653-122108675 CAGCCTGAGGCCCTCACCAGGGG - Intergenic
1061970100 9:134040299-134040321 CTGGGCACGGCCCACACCACTGG + Intronic
1062263867 9:135677877-135677899 CTGCCCGCTGCCGTCAGCACAGG - Intergenic
1062452418 9:136621207-136621229 CTGCCGGCCGCCCTCTCCGCAGG + Intergenic
1190258787 X:48785329-48785351 CTGCCCTCAGCCCTCAGCAGGGG - Intergenic
1190783687 X:53623094-53623116 CTGCCCGTGTCCCTCACTTCTGG + Intronic
1197672540 X:129293930-129293952 CTCCCCGCTCCCCCCACCACAGG - Intergenic
1200052081 X:153438891-153438913 CTGCCAGCTGCCGTCACCTCAGG + Intergenic
1200448406 Y:3293739-3293761 CTGCCCGGGGCCCTCAGCCAAGG - Intergenic
1201943460 Y:19484035-19484057 CTCCCCTCAGCCCTCACCCCAGG - Intergenic