ID: 1160467493

View in Genome Browser
Species Human (GRCh38)
Location 18:79093731-79093753
Sequence AATTCTAAGCAGATGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 318}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160467493_1160467499 -8 Left 1160467493 18:79093731-79093753 CCCTCCCCCATCTGCTTAGAATT 0: 1
1: 0
2: 3
3: 34
4: 318
Right 1160467499 18:79093746-79093768 TTAGAATTTCTGTCTACCCTAGG 0: 1
1: 0
2: 1
3: 15
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160467493 Original CRISPR AATTCTAAGCAGATGGGGGA GGG (reversed) Intronic
900894874 1:5476361-5476383 AATCCTAAGCAAATGGAAGAGGG + Intergenic
901516457 1:9750300-9750322 TGTTCTAAGCAGGTGGGGGTAGG - Intronic
901789745 1:11647936-11647958 CCTTCCAAGCAGCTGGGGGAGGG + Intergenic
902338169 1:15765726-15765748 AGTACTAAGCAGATGGCAGATGG - Intronic
903380004 1:22890173-22890195 AACTCTAAGCCCATGAGGGAGGG - Intronic
904024214 1:27492019-27492041 AATGCTAAGGGGATGGGTGAGGG - Intergenic
905658378 1:39701135-39701157 AATTATAAGCATGTGGGGGAGGG + Intronic
907481792 1:54750052-54750074 AATTCTGAACAGATCAGGGATGG + Intergenic
908031836 1:60008865-60008887 AATGCCAAGCAGCTGGAGGAAGG - Intronic
909570590 1:77105437-77105459 AATTCTAGGCAGATAGGGGTGGG - Intronic
909692687 1:78427020-78427042 AATTCTAAGCAGTAGAGGGTTGG + Intronic
911377610 1:97070117-97070139 AATCCTAAGCAAATGTGAGAAGG + Intergenic
914902293 1:151717120-151717142 AAGACTCAGCAGATGGGGGGTGG + Intronic
915447833 1:155984225-155984247 AATTCTATGCAGCTCAGGGAAGG + Intronic
916127663 1:161585757-161585779 AATTCAAGCTAGATGGGGGAGGG + Intronic
916137581 1:161667561-161667583 AATTCAAGCTAGATGGGGGAGGG + Intronic
917315500 1:173720546-173720568 ATTTCTAGGCACATAGGGGATGG + Intronic
917790842 1:178497807-178497829 ATTAATAAGCAGATCGGGGAGGG + Intergenic
918792548 1:188847422-188847444 AATTCTAGGCAGACAGGGGCGGG - Intergenic
919106964 1:193165749-193165771 AATTTTATGCATATGTGGGAGGG - Intronic
919314513 1:195954486-195954508 AATTCTATGCAGAAGAGGGAAGG + Intergenic
919948341 1:202339736-202339758 AATTCAAAGTATATGGGGGTGGG + Intronic
920666452 1:207966085-207966107 AAGTCTAAAAAGATGGGGGCAGG + Intergenic
920794088 1:209121748-209121770 AATACTTAGCAGATAGGGAAAGG - Intergenic
921263557 1:213404303-213404325 TATTCACAGCAGCTGGGGGATGG + Intergenic
921433633 1:215091228-215091250 CATTCTAAGCAGAATGGGCATGG + Intronic
921670207 1:217916582-217916604 CATTCTAAGTAGAAGAGGGATGG + Intergenic
922048350 1:221967758-221967780 ATTGCTAGGCAGGTGGGGGAGGG - Intergenic
922913929 1:229240225-229240247 AATTCTAAGCAGACAGGGATGGG - Intergenic
923803993 1:237238324-237238346 AACTCGAAGCTGTTGGGGGAGGG - Intronic
1064301443 10:14126602-14126624 TATTCTATGCAGATGGGAGAAGG - Intronic
1064927122 10:20581753-20581775 AATTCTATGCAGAAAAGGGAGGG + Intergenic
1065081742 10:22136223-22136245 CCTCCTAAGCAGCTGGGGGAAGG + Intergenic
1065875686 10:29995516-29995538 GCTTGAAAGCAGATGGGGGATGG + Intergenic
1065979473 10:30878073-30878095 AATTCTAGGCAGACAGGGGCGGG + Intronic
1066368294 10:34797742-34797764 AGTTGTAATGAGATGGGGGAAGG - Intronic
1067772158 10:49134453-49134475 CATTCTCAGCAAATGGGGAAGGG + Intergenic
1070470650 10:76775717-76775739 AATTCTGGGCAGATGAAGGAGGG - Intergenic
1070589898 10:77794285-77794307 AGCTCTGGGCAGATGGGGGAAGG + Intronic
1071152644 10:82652742-82652764 AATTCTAGGCAGACAGGGGTGGG - Intronic
1072014044 10:91328301-91328323 GGTGCTAAGCAGAAGGGGGAGGG - Intergenic
1072543867 10:96419253-96419275 AATCCGATGCAGATGGGTGAGGG - Intronic
1072905479 10:99449339-99449361 AAGTCTAGGCAGAAGGTGGAAGG + Intergenic
1073160978 10:101394673-101394695 AATTCTTAGCAGTCGGGGCAGGG + Intronic
1074591322 10:114816499-114816521 AATTCTTAGCCAATAGGGGATGG - Intergenic
1075086897 10:119419707-119419729 CCTTCTCAGCAGATGGGAGAAGG - Intronic
1075804569 10:125176838-125176860 AATTGCAAGGAGATGGGGTAGGG + Intergenic
1077212420 11:1377684-1377706 AGTTGCAAGCAGATGGGGGATGG + Intergenic
1077275658 11:1706299-1706321 AATCCCAGGCAGATGGGGGTGGG + Intergenic
1077471637 11:2764879-2764901 AAGACTGATCAGATGGGGGAGGG - Intronic
1078414085 11:11150889-11150911 AATTCTCAAGAGATGGGGTATGG + Intergenic
1079573705 11:21976669-21976691 AATTCTAGGCAGAGAGGGGTGGG - Intergenic
1080604467 11:33853256-33853278 AATTCTAGGCAGACAGGGGTGGG - Intergenic
1081982205 11:47274813-47274835 ATCTCTAAGGAGAAGGGGGAAGG + Exonic
1084969754 11:72764678-72764700 AATTCTAAGAGGCTTGGGGAGGG + Intronic
1085445343 11:76597543-76597565 AATACTAAGCAGATGGATGGTGG - Intergenic
1085445691 11:76599283-76599305 GGTTCTTAGCAGCTGGGGGAGGG - Intergenic
1086437881 11:86800089-86800111 AGTTCTAGGCTGTTGGGGGAGGG + Intronic
1088722369 11:112605646-112605668 AACTGGAAGCAGATGGGGAATGG + Intergenic
1089108553 11:116035991-116036013 AAATATCAGCAGTTGGGGGAGGG + Intergenic
1090526872 11:127546669-127546691 ATTGCTGAGCAGGTGGGGGAGGG + Intergenic
1091055975 11:132419550-132419572 AAATCTCTGCAGATGGTGGAAGG + Exonic
1092474429 12:8806737-8806759 ATTTCTGGGCAGGTGGGGGAGGG - Intergenic
1093731291 12:22568458-22568480 AATTCTAGGCAGACAGGGGCGGG - Intergenic
1094070187 12:26404197-26404219 AACTGTAGGCAGAAGGGGGAAGG + Intronic
1094172213 12:27505570-27505592 AACTCTCAGCAGATGGGGAATGG - Intergenic
1095221515 12:39621463-39621485 AATTTTAATGAGATGGGGGGCGG - Intergenic
1095992819 12:48049282-48049304 AATTCTGACTAGAAGGGGGAAGG + Intronic
1097274770 12:57805473-57805495 ACTTCTATGCAGATGGAGGCTGG - Intronic
1097542259 12:60955921-60955943 ATTTCTGGGCAGGTGGGGGAAGG + Intergenic
1101148820 12:101866300-101866322 AATTCTAGGCAGACAGGGGCAGG + Intergenic
1102531193 12:113547660-113547682 AAATCAAAGCAGAGGTGGGAGGG + Intergenic
1103970685 12:124669160-124669182 ATCTCTGAGCAGATGGGGAAAGG - Intergenic
1104168531 12:126257474-126257496 AATTCTAAGCAAATTAAGGAAGG + Intergenic
1104464773 12:128981322-128981344 AATAGTAAGCAGAGCGGGGAAGG + Intronic
1108316505 13:49242355-49242377 AATTCTAGGCAGACAGGGGCAGG + Intergenic
1108615834 13:52131133-52131155 ACAGCTAAGCAGATGGCGGATGG + Intergenic
1109705847 13:66092146-66092168 AATTCTAGGCAGACAGGGGTGGG + Intergenic
1109882983 13:68506596-68506618 AATTCTAGGCAGACAGGGGCAGG + Intergenic
1110070682 13:71173218-71173240 AATTCTTAGAAGTTGGGAGATGG + Intergenic
1111986683 13:95073055-95073077 AACTTTAAACAGATGGAGGAAGG + Intronic
1114150383 14:20031883-20031905 AAATGCAAGCAGGTGGGGGATGG + Intergenic
1114200754 14:20517870-20517892 AATACTCAGCAGCTGTGGGATGG - Intergenic
1114686476 14:24536809-24536831 AAATCCAAGAAAATGGGGGAGGG - Intergenic
1115178464 14:30593538-30593560 AATTCCAAGCAAATGGTGCATGG - Exonic
1116645760 14:47526918-47526940 AACTCAAAGCAGATGGGGCTTGG - Intronic
1116716408 14:48431753-48431775 AATTCTAGGCAGACAGGGGCGGG - Intergenic
1116787490 14:49303621-49303643 ATCTCTAAGCTGATGGGGGTTGG + Intergenic
1117163515 14:53011781-53011803 AATTCAATGGAGATGGGGGAGGG + Intergenic
1117348710 14:54859615-54859637 GATTCTCAGCAGATGAGGGCAGG + Intronic
1117531876 14:56667513-56667535 AAATACAAGCAGATGGGGGGAGG + Intronic
1119386193 14:74259377-74259399 AGTTCTAGGGAGATGGGGTATGG - Intronic
1120901144 14:89576670-89576692 AATTCTATACAGATAAGGGAAGG - Intronic
1122497481 14:102169180-102169202 GATTCTAAGCAGAGGGGCTAAGG - Intronic
1124723468 15:32133686-32133708 AATTCACAACAGATGAGGGAAGG + Intronic
1125006467 15:34822983-34823005 AATTCCACGCACATGGCGGAGGG - Intergenic
1126767923 15:52027416-52027438 AAATCCAAGCAGGAGGGGGAGGG - Intronic
1127207767 15:56738070-56738092 AACTCTGAGAAGCTGGGGGATGG + Intronic
1127647963 15:60976321-60976343 CATATTATGCAGATGGGGGATGG - Intronic
1128065618 15:64762818-64762840 AGCTCTGAGCAGATGGAGGATGG - Intronic
1129108823 15:73325690-73325712 AATACTAAGGAGGTGGGTGAGGG + Intronic
1129259372 15:74355694-74355716 ATTACTGGGCAGATGGGGGAGGG - Intronic
1129553188 15:76475601-76475623 AATTAAAAGCTGATGGGGCATGG - Intronic
1129656054 15:77526506-77526528 GGTTCTGAGAAGATGGGGGAAGG - Intergenic
1129843115 15:78755788-78755810 AATTCGCAGCAGATGTGGGGAGG - Intergenic
1130954202 15:88615365-88615387 CATTCTCAGGAGTTGGGGGAGGG + Intergenic
1131695788 15:94876274-94876296 AATCCTAGGCAGATGGGAGCAGG - Intergenic
1133418273 16:5623641-5623663 CATTACAAGCAGCTGGGGGAAGG - Intergenic
1134374058 16:13653405-13653427 GAATCTAGGCAGATGGAGGAAGG + Intergenic
1135392800 16:22107780-22107802 ATTTCTAACAAGCTGGGGGATGG + Intronic
1135887977 16:26329615-26329637 AATTCTAGGTAGAAGAGGGAGGG - Intergenic
1140442718 16:74999598-74999620 ACTTCTCAGCAGCAGGGGGAGGG - Exonic
1140879391 16:79184152-79184174 AGTTCTGAGCATTTGGGGGAGGG - Intronic
1140986511 16:80162962-80162984 AGTTTTAAGAAGAAGGGGGAAGG - Intergenic
1141402798 16:83765119-83765141 ATATGTAAGCAGATGTGGGATGG - Intronic
1142301813 16:89263019-89263041 AATTCTAGGCAGACAGGGGCAGG - Intergenic
1143358323 17:6347510-6347532 AATTCTGAGAAGATGAGGGCTGG - Intergenic
1144356505 17:14451754-14451776 AGTTCTAACAAGATGAGGGATGG - Intergenic
1144430960 17:15191427-15191449 AGCTCTCAGCAGATGAGGGAAGG + Intergenic
1146607559 17:34274037-34274059 AATTCTAACCAGTTGGGTGAGGG + Intergenic
1146745417 17:35324332-35324354 AACTCTAAGCAGACAGGGGAGGG - Intergenic
1147888805 17:43702722-43702744 AGCTCTTAGCAGAAGGGGGAAGG - Intergenic
1148627045 17:49077580-49077602 AATACCAAGCAGATAGAGGAGGG + Intergenic
1148998718 17:51735042-51735064 TATTCTAAGAAGATGGGTTAAGG - Intronic
1149435497 17:56630166-56630188 AACTCTGAGCAGCTGGGGGCAGG + Intergenic
1150932031 17:69595635-69595657 AATTCTAGGCAGACAGGGGTGGG + Intergenic
1151783528 17:76263703-76263725 GAGTTTAAGCAGATTGGGGAAGG - Intergenic
1153703163 18:7717112-7717134 AATTCTAGGCAGAAAAGGGATGG + Intronic
1153801202 18:8670897-8670919 AATTCTAAGCATGTTGTGGAAGG - Intergenic
1153997818 18:10456319-10456341 AATTCTAAGCAGATGGGCCTAGG - Intronic
1154174575 18:12076871-12076893 AATTATAACCAGATGGTAGAAGG + Intergenic
1154384412 18:13880268-13880290 AATTCTAGGCAGACAGGGGTGGG + Intergenic
1155329156 18:24697374-24697396 TATTTAAAGCAGATGGGGAAAGG + Intergenic
1155799923 18:30089108-30089130 AATTCTAGGCAGACAGGGGAAGG + Intergenic
1155845284 18:30697501-30697523 AATTCTAAGCAGATGTATCAGGG - Intergenic
1156108514 18:33694570-33694592 ATTTAGAAGCAGTTGGGGGATGG - Intronic
1156886079 18:42138089-42138111 GATTCTAAACAGATGGGGAAAGG + Intergenic
1156905547 18:42348309-42348331 AATTCTAGGCAGACAGGGGGAGG + Intergenic
1156946970 18:42844832-42844854 AATTCTAGGCAGATAGGGGCAGG - Intronic
1158950857 18:62493323-62493345 CATTATAAGCAGATGGGGTGGGG - Intergenic
1159666066 18:71162035-71162057 AATTCTAGGCAGAAGAGGGCAGG + Intergenic
1159777551 18:72620704-72620726 AATTCTAGGCAGACGAGGGTAGG - Intronic
1160467493 18:79093731-79093753 AATTCTAAGCAGATGGGGGAGGG - Intronic
1160582323 18:79891082-79891104 AACTTAAAGCAGGTGGGGGAAGG - Intronic
1161893758 19:7064318-7064340 TATTCTCAGCAGCTGGGGGATGG - Intergenic
1163839028 19:19594433-19594455 AAGCCTAGGCAGATGGGGGTAGG + Intronic
1164092144 19:21966258-21966280 AATTCTAAAAAGAAGGAGGAAGG - Intronic
1164196285 19:22965577-22965599 AATTCTAAAGAGAAGGAGGAAGG - Intergenic
1166664717 19:44672090-44672112 AATTAGAATAAGATGGGGGAGGG + Intronic
926390648 2:12388176-12388198 AAATCTAAGCAGATTGTGAAAGG - Intergenic
926918647 2:17917536-17917558 AATTCTCAGCAAGTGGGGGGTGG - Intronic
929419023 2:41772093-41772115 AAATCTTAGCAGATGGGGTAGGG + Intergenic
929444158 2:41989763-41989785 AGTTCTAAGCAGAGAGAGGAAGG + Intergenic
929569319 2:43010156-43010178 TACTCTTAGCAGTTGGGGGAAGG - Intergenic
929666280 2:43836571-43836593 CGTTCTCAGCAGCTGGGGGATGG - Intronic
930515384 2:52401463-52401485 AATTCTAGGCAGACAGGGGTGGG + Intergenic
930525472 2:52524475-52524497 AATTCTAGGCAGACAGGGGAGGG + Intergenic
930653148 2:53982580-53982602 AATTCTAGGCAGTGGGTGGAAGG - Intronic
932556348 2:72828207-72828229 AATTCCAAACAGATGTAGGAGGG + Intergenic
933791224 2:85885464-85885486 AGTTCTAAGGAGACTGGGGAAGG - Intronic
936244947 2:110818617-110818639 AATTTTAAAAAGACGGGGGATGG + Intronic
940173182 2:150850353-150850375 AATCCTAGGCAGATGGGGGTGGG - Intergenic
940523080 2:154776356-154776378 ACTTCCTAGCAGATGGGGGTTGG - Intronic
940838300 2:158549583-158549605 AATTCCAAGCAGAGGGGCAATGG - Intronic
941978411 2:171430699-171430721 AATCCTAGGCAGATGGGGGTGGG + Intronic
942326738 2:174782354-174782376 ACTTCTAAGGAGATGGTGGAAGG - Intergenic
944454472 2:199878856-199878878 AATTCTTAGCAGAAGAGGGTGGG - Intergenic
945044118 2:205766851-205766873 AATTCACATCACATGGGGGAAGG - Intronic
945837480 2:214849916-214849938 AATTCTCAGCAAATAAGGGAAGG + Intergenic
945856511 2:215075137-215075159 AATCCTTAGCAGAAGGGAGATGG + Intronic
947064314 2:226204200-226204222 AAGTCTCAGCAAATTGGGGATGG - Intergenic
947390799 2:229637222-229637244 AATTCTAAACTGATGGGGTTGGG - Intronic
948444013 2:238018094-238018116 AAGTCTCAGCAGGTGGTGGATGG - Intronic
1168949262 20:1785377-1785399 AAGTCTAAGAAGATGGGGTGAGG - Intergenic
1169633199 20:7656994-7657016 CATTCTAGGGAGAGGGGGGAGGG + Intergenic
1170338227 20:15294741-15294763 AATTCCACACAGTTGGGGGAAGG - Intronic
1171151251 20:22828122-22828144 CATTCCAAGGAGATGAGGGAGGG - Intergenic
1175653051 20:60745392-60745414 AATCCTAAGCAGATGGAGGAGGG - Intergenic
1176692604 21:9934204-9934226 AACTCAAAGCAGGTGGGGGTGGG - Intergenic
1177679186 21:24341810-24341832 AATTTTTCACAGATGGGGGAAGG + Intergenic
1177850737 21:26345140-26345162 AATTCTGAGCAGTTGGAGCAGGG - Intergenic
1177962136 21:27680295-27680317 AATTCTTGGCAGACAGGGGAGGG - Intergenic
1177968408 21:27758724-27758746 AATTCTAGGCAGACAGGGGCAGG + Intergenic
1178750918 21:35302309-35302331 AGTTCTAAGAAAATTGGGGAAGG - Intronic
1179000671 21:37455100-37455122 AATTCTTGGGAGATGGGGGAGGG + Intronic
1182485298 22:30635557-30635579 AATGCCAGGCCGATGGGGGAGGG + Intergenic
1183035041 22:35134935-35134957 AATTCTGACCTGATAGGGGAGGG + Intergenic
1184107548 22:42376946-42376968 AATTGAAAGGAGGTGGGGGAGGG + Intergenic
1185296566 22:50057858-50057880 AGTTCCCAGAAGATGGGGGAAGG + Intergenic
949258697 3:2081222-2081244 AATTCTAGGCAGACAGGGGTGGG + Intergenic
950997410 3:17518156-17518178 AATTCTAAGCAGAAAAGGGTGGG + Intronic
951719438 3:25682324-25682346 AATTCAAAGTAGATGAAGGAAGG + Intergenic
951912762 3:27768651-27768673 AGTTCTAAGCAGTTGGAGGAGGG - Intergenic
951931697 3:27974270-27974292 AATTCTAGGCAGAAAAGGGAGGG - Intergenic
952181401 3:30920396-30920418 AATTCTAGGCAGACAGGGGCAGG + Intergenic
952205009 3:31172469-31172491 ATTTCACTGCAGATGGGGGAAGG + Intergenic
952790544 3:37197171-37197193 CATTCACAGCAGCTGGGGGATGG - Intergenic
955615309 3:60800953-60800975 CACTCTAAGCAGCTGGGGCATGG + Intronic
955852739 3:63238475-63238497 ATATCTCAGCAGATGGGAGAGGG - Intronic
956457588 3:69438682-69438704 AGTTCAAAGCAGTTGAGGGAGGG + Intronic
956486545 3:69728927-69728949 AGATCTATGCAGATGTGGGAGGG - Intergenic
956545332 3:70395077-70395099 GCTGCTAAGCAGTTGGGGGATGG - Intergenic
956678678 3:71757931-71757953 AGTTCTGATTAGATGGGGGAAGG + Intergenic
957343811 3:78936651-78936673 ATTTGTAAGTATATGGGGGAGGG + Intronic
957855401 3:85869954-85869976 AAATCTAGGCAGATAGGGCAGGG - Intronic
959943160 3:112100817-112100839 AATTTTAAGCACATGGGAAATGG + Intronic
960593997 3:119391659-119391681 AATTCTAAGCAGATTGTAGGTGG + Intronic
960725785 3:120668416-120668438 AAGTCTAAGCACTTAGGGGAGGG + Intronic
962105752 3:132387040-132387062 AATTCTGAGCAAATGGTGCATGG - Intergenic
962338253 3:134557897-134557919 AATTCCAAGAAGGTGGAGGAAGG - Intronic
963708827 3:148722535-148722557 CATTCTAAGAAGAGGCGGGAGGG + Intronic
964479965 3:157130451-157130473 TACTCTAAGCAGATGGGACAGGG - Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966402842 3:179563981-179564003 AATTCCTAGCCGATGGGGGTGGG + Intronic
969654170 4:8486756-8486778 ATTGCTGGGCAGATGGGGGAGGG + Intronic
971959871 4:33471643-33471665 AATTCTAGGCAGACAGGGGTGGG - Intergenic
972240462 4:37186360-37186382 AGTTATAAGGAGATGAGGGATGG + Intergenic
973022504 4:45220792-45220814 AATTCTAGGCAGACAGGGGCAGG - Intergenic
973185577 4:47324280-47324302 AATTCTAAGCACAGCGGGCAGGG - Intronic
973200820 4:47500202-47500224 ATTTCTACGCTGATGGAGGAGGG + Intronic
973824137 4:54688149-54688171 AATAGCATGCAGATGGGGGAGGG - Intronic
974022212 4:56701808-56701830 CTTTCTAAACGGATGGGGGAGGG + Intergenic
974175905 4:58323871-58323893 AATTTTAGGTAGATGGGTGAAGG + Intergenic
975666048 4:76736026-76736048 AATTCTCAGCAGTTGGGAGGAGG + Intronic
975854418 4:78608114-78608136 AATTATAAGCAAAGGGGGTAGGG + Intronic
976883656 4:89960801-89960823 AATTCTAGGCAGAAAGGGCAGGG - Intergenic
978119653 4:105063071-105063093 AATTCTCAGAAGATGGAAGATGG - Intergenic
979184315 4:117770130-117770152 AATTCTAAGCAGAAAAGGGCAGG + Intergenic
979274828 4:118803411-118803433 AAGACTAGGGAGATGGGGGAGGG - Intronic
979946759 4:126842862-126842884 AATTCTAGGCAGATAGGGGCAGG + Intergenic
980365188 4:131794416-131794438 AACTCAAAGCAGGTGGGGGTGGG - Intergenic
980538187 4:134158131-134158153 ATTTGTAGGGAGATGGGGGAGGG - Intergenic
981234571 4:142399854-142399876 AATGCTTAGCAGGTGGGGGAGGG - Intronic
983650054 4:170028118-170028140 AATTTAAAAGAGATGGGGGAGGG - Intronic
983697927 4:170554989-170555011 AATTCTAGGCAGACAGGGGCAGG - Intergenic
983773538 4:171578385-171578407 AATTCTAGGCAGACAGGAGAAGG - Intergenic
984393678 4:179168800-179168822 AATTGTGGGCAGGTGGGGGAGGG + Intergenic
985048960 4:185970692-185970714 AATTCTAGGCAGAAGAGGGCAGG - Intergenic
986193472 5:5517357-5517379 AATGCTGGGCAGGTGGGGGAGGG - Intergenic
986388816 5:7265386-7265408 AATGCTGGGCAGGTGGGGGAGGG - Intergenic
986624788 5:9713470-9713492 AATTCAAAGCAGTGGGGGGTGGG - Intergenic
987650283 5:20732471-20732493 AATTCTAACATGTTGGGGGAGGG - Intergenic
988709421 5:33758612-33758634 AATTCTGAGCAGAAGGAGGAAGG + Intronic
988745269 5:34128997-34129019 AATTCTAACATGTTGGGGGAGGG + Intergenic
989168618 5:38453901-38453923 GATCCTAAGCAGGTGGGAGAGGG - Intronic
990124616 5:52498858-52498880 AAGCCTAAGGAGGTGGGGGAGGG - Intergenic
990293402 5:54378139-54378161 AATTCTAGGCAGACAGGGGCAGG + Intergenic
990683812 5:58277683-58277705 AACTCTAAGCAGACAGGGGCAGG + Intergenic
991278665 5:64883570-64883592 AATTCTAAGAAGAAAGGAGAAGG + Intronic
992229978 5:74654575-74654597 CTTTCTAGGCAGATGAGGGAAGG + Intronic
992986327 5:82234209-82234231 ACTTTTAGGCAGATGGGGGAGGG + Intronic
993318595 5:86443233-86443255 AATTTTAACCACATGAGGGAGGG + Intergenic
993761563 5:91802411-91802433 ATGCCTAGGCAGATGGGGGAGGG + Intergenic
994284469 5:97948436-97948458 TATGTTAATCAGATGGGGGAGGG - Intergenic
994735417 5:103547939-103547961 TATTCTGTGCAGATCGGGGAGGG - Intergenic
996708423 5:126520377-126520399 GCTTTTAGGCAGATGGGGGAGGG - Intergenic
998644040 5:144042525-144042547 AATTCTGGGCAGAAGAGGGAGGG - Intergenic
1000244835 5:159440710-159440732 GACTCTAAGCACATGGGGGCAGG + Intergenic
1000245845 5:159447802-159447824 AACTCTCAGCTGATGGGGTAAGG + Intergenic
1000439657 5:161250266-161250288 ATTGCTGGGCAGATGGGGGAGGG - Intergenic
1001461914 5:171923868-171923890 AATCCTAGGCAGACAGGGGAGGG + Intronic
1002134294 5:177098450-177098472 AATGCTGAGCAGATGGGGGAGGG - Intergenic
1002661516 5:180793616-180793638 AATTCAAAGCAGAAGTGGAAAGG + Intronic
1004438392 6:15620753-15620775 TATGCTTAGCATATGGGGGACGG + Intronic
1005543392 6:26836745-26836767 AATTCTAACATGTTGGGGGAGGG + Intergenic
1005562054 6:27050377-27050399 AGTTTTCAGCAGATGAGGGATGG - Intergenic
1006757956 6:36433490-36433512 AATGGTAGGCAGATGGGGAAGGG + Intronic
1006947958 6:37798085-37798107 TTTTCTAAGCAGATGAGGGGAGG - Intergenic
1007049574 6:38813402-38813424 AAATACAAGCAGATGGGGGGTGG - Intronic
1007164887 6:39822134-39822156 AAGTCTATGCAGCAGGGGGATGG + Intronic
1008253210 6:49265621-49265643 ATTCCTAAGCAGATAGGGGCAGG - Intergenic
1009014217 6:57878915-57878937 AATTCTAACATGTTGGGGGAGGG + Intergenic
1009343546 6:62587743-62587765 ATTTCTGAGCAGGTGGGGGAGGG - Intergenic
1009960693 6:70517238-70517260 AAGTCTATCCAGGTGGGGGATGG + Intronic
1010104469 6:72150421-72150443 AATCCTAAACAGATAGGGGTGGG - Intronic
1010294664 6:74182373-74182395 AATTCTAGGCAGACAGGGGTAGG + Intergenic
1010730254 6:79383088-79383110 TATTCCCAGCAGCTGGGGGATGG + Intergenic
1011280616 6:85673486-85673508 AATCCCAAGCTGATCGGGGAAGG - Intergenic
1011818913 6:91227505-91227527 AATCCTGGGGAGATGGGGGATGG - Intergenic
1012244964 6:96915865-96915887 GCTTTTAAGCCGATGGGGGAGGG - Intergenic
1013995666 6:116304775-116304797 CATTCTAGGCAGATGAGGGCTGG - Intronic
1014275572 6:119384547-119384569 TATTTTATGGAGATGGGGGAGGG + Intergenic
1014740571 6:125143832-125143854 AATTCTAGGCAGACAGGGAAAGG - Intronic
1015376213 6:132513076-132513098 AATTCTCAGCTGATGGGCGGTGG + Intronic
1015981600 6:138845197-138845219 AATTCTAAGCAGATGCACAATGG - Intronic
1017998965 6:159561260-159561282 AATTCTAGGCAGAAGGGGGCGGG - Intergenic
1019131914 6:169883159-169883181 AAATCTTTGCAGATGGAGGAAGG + Intergenic
1019803642 7:3106541-3106563 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1019803771 7:3107586-3107608 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1021015340 7:15525216-15525238 AATCCTAGGCAGATAGGGGTGGG + Intronic
1021456765 7:20837931-20837953 AATTAAAAGCAGATGCTGGACGG + Intergenic
1021787480 7:24165804-24165826 ATTCCTAGGCAGATAGGGGAAGG - Intergenic
1023228692 7:38000659-38000681 CAATCTATGCTGATGGGGGATGG + Intronic
1023327216 7:39073482-39073504 AATTCCAAGGAGATGGGGGTGGG - Intronic
1024414922 7:49095787-49095809 ATTTCTCAGCAGTCGGGGGAGGG + Intergenic
1026280963 7:68921498-68921520 AATTCTAGGCAGAAGAGGGTGGG + Intergenic
1026617494 7:71918774-71918796 AATTCCAAGGAGCTGGGGGCTGG - Intronic
1029210370 7:98903394-98903416 TATTCTCAGCAGATGGTGAAAGG + Exonic
1030249669 7:107428244-107428266 AATCCTAAGCAGACAGGGGCAGG - Intronic
1031035019 7:116779493-116779515 AATTTTAAACAGATTAGGGAAGG - Intronic
1031275726 7:119720760-119720782 AATTCAGAACAGATGGAGGAAGG - Intergenic
1031696123 7:124857347-124857369 AATTCTACGCAGAAGAGGGCAGG + Intronic
1032619293 7:133511528-133511550 ACTTTTAGGCAGATGGGGGAGGG + Intronic
1032668285 7:134060191-134060213 TATTATAAGCAGATAGGTGAGGG - Intronic
1034158634 7:148976112-148976134 ATTTCTAATCAGATGGGGTGGGG + Intergenic
1034577345 7:152011791-152011813 AATTCTGAGCAGATGGGCCAAGG - Intronic
1037331428 8:17747482-17747504 AATTCTAGGCAGACGGGGGCAGG + Intronic
1037363240 8:18095952-18095974 AATTCTGAGCAGGGTGGGGAGGG - Intergenic
1037483782 8:19328696-19328718 ATTTCTGAGCAGATGGTGCAAGG - Intronic
1039019344 8:33187849-33187871 GCTTTTAGGCAGATGGGGGAGGG - Intergenic
1040663626 8:49604517-49604539 AATTCTAGGCAGACAGGGGTGGG + Intergenic
1042445955 8:68885191-68885213 AATTCTAGGCAGAAGAGGGCAGG - Intergenic
1042799517 8:72703461-72703483 AATTGTCAGCAGTTGGGGCAAGG + Intronic
1044525834 8:93250455-93250477 AATTCTGAGCATATGGGAGAAGG - Intergenic
1045197456 8:99945670-99945692 ATTGCTGGGCAGATGGGGGAGGG - Intergenic
1045768887 8:105710449-105710471 ATTTGTAAGCAGATGGTGAAAGG + Intronic
1048585484 8:135771057-135771079 ATTGCTGAGCAGGTGGGGGAGGG + Intergenic
1048764302 8:137828757-137828779 ATTGCTAGGCAGGTGGGGGAGGG + Intergenic
1048800351 8:138188928-138188950 AATTCTGGGCAGAAGAGGGAAGG + Intronic
1048888104 8:138924724-138924746 CATTCTAAGCACATGGGGTGGGG - Intergenic
1049519340 8:143080278-143080300 ATTTGGAAGCAGACGGGGGAGGG - Intergenic
1051144075 9:14007803-14007825 AGCTCTCAGCAGATGGGGGAAGG - Intergenic
1052052895 9:23867848-23867870 AATTCTAAGTAGATTGAGGAGGG + Intergenic
1052122234 9:24731555-24731577 AATTCTAGGCAGATGGGGGTGGG - Intergenic
1052216384 9:25971780-25971802 AATTCTAGGCAGACAGGGGTCGG + Intergenic
1052566530 9:30160510-30160532 AGCTCTCAGTAGATGGGGGATGG + Intergenic
1052720705 9:32168465-32168487 AATTGCAGGCAGGTGGGGGAAGG + Intergenic
1052806275 9:33016670-33016692 AATTCTAAAAAAATGGGGGGGGG - Intronic
1053629546 9:39920269-39920291 AACTCAAAGCAGGTGGGGGTGGG - Intergenic
1053776220 9:41543278-41543300 AACTCAAAGCAGGTGGGGGTGGG + Intergenic
1054214341 9:62330433-62330455 AACTCAAAGCAGGTGGGGGTGGG + Intergenic
1054365512 9:64335212-64335234 AACTCAAAGCAGGTGGGGGTGGG - Intergenic
1054673143 9:67824925-67824947 AACTCAAAGCAGGTGGGGGTGGG - Intergenic
1056452625 9:86730816-86730838 CTTTCTAAGCAGGTGGGGAAAGG - Intergenic
1057243150 9:93430597-93430619 AATTCAAAGCACATGGGGATGGG + Intergenic
1057405799 9:94769718-94769740 AATTGTAAGCACACTGGGGAGGG + Intronic
1058829210 9:108800282-108800304 AATTCTAGGCAGACAGGGGTGGG + Intergenic
1060276586 9:122187285-122187307 AATTAAAAGCAGATGGGAGGAGG - Intronic
1186223200 X:7371434-7371456 AATTCTAGGCAGAAGGTGGTAGG + Intergenic
1187451510 X:19401020-19401042 AATTCTAAGCAAACTGTGGATGG - Intronic
1189925901 X:45954436-45954458 ATTTCTACCCAGATGGTGGAGGG - Intergenic
1190804508 X:53822094-53822116 AATTCTAAGCAGAGTGTTGAAGG - Intergenic
1191057306 X:56254966-56254988 AATTCTAGGCAGAAGTGGGCAGG - Intronic
1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG + Intergenic
1192454523 X:71265972-71265994 ATTTTTGGGCAGATGGGGGAGGG - Intergenic
1195430506 X:104784033-104784055 AATTATTGGCAGCTGGGGGAGGG - Intronic
1195841416 X:109180192-109180214 ATTTCTGGGCAGGTGGGGGAAGG - Intergenic
1195853274 X:109305862-109305884 AATTCTAGGCAGATAGCGGCAGG - Intergenic
1195854136 X:109311801-109311823 AATTCTAGGCAGACAGGGGTGGG - Intergenic
1197548733 X:127861677-127861699 AATTCTAAGCAGCTGCTGCAAGG + Intergenic
1198599460 X:138268218-138268240 ATTGCTGAGCAGGTGGGGGAGGG + Intergenic
1201592759 Y:15633703-15633725 AATTCCAGGCAGAAGGTGGAAGG + Intergenic
1202176510 Y:22103581-22103603 AATTCTAGGATGATGGAGGAGGG + Intergenic
1202180629 Y:22136836-22136858 AATCCTAAGATGATGGAGGAGGG + Intergenic
1202210731 Y:22449563-22449585 AATCCTAAGATGATGGAGGAGGG - Intergenic
1202214851 Y:22482803-22482825 AATTCTAGGATGATGGAGGAGGG - Intergenic