ID: 1160469656

View in Genome Browser
Species Human (GRCh38)
Location 18:79117592-79117614
Sequence TAGTTGGAAAGGAGGTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 338}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160469651_1160469656 2 Left 1160469651 18:79117567-79117589 CCAGGAGGGTGTGGGTGGGAAGA 0: 1
1: 1
2: 4
3: 56
4: 471
Right 1160469656 18:79117592-79117614 TAGTTGGAAAGGAGGTCAGAGGG 0: 1
1: 0
2: 4
3: 37
4: 338
1160469643_1160469656 22 Left 1160469643 18:79117547-79117569 CCAGGGTGGGAGGAGGTCATCCA 0: 1
1: 0
2: 1
3: 28
4: 172
Right 1160469656 18:79117592-79117614 TAGTTGGAAAGGAGGTCAGAGGG 0: 1
1: 0
2: 4
3: 37
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160469656 Original CRISPR TAGTTGGAAAGGAGGTCAGA GGG Intronic
900619067 1:3578700-3578722 TTGTTGGAAAGGCGGACAGTTGG - Intronic
901897287 1:12325000-12325022 GAGATGGAAAGGAAGTGAGATGG - Intronic
902206698 1:14873567-14873589 TAAAAGGAGAGGAGGTCAGAGGG + Intronic
902957935 1:19939418-19939440 TTGTTGCAAAGGAGATAAGATGG + Intergenic
903042259 1:20540168-20540190 ATGTTGGAAAGGAGCTCACAAGG + Intergenic
903369335 1:22825219-22825241 CAGTTGGATAGATGGTCAGAAGG + Intronic
903627540 1:24742353-24742375 TGGTAGGAGATGAGGTCAGAGGG + Intergenic
904013927 1:27406120-27406142 TAGTTGGAGAGGCAGGCAGAGGG - Exonic
904865667 1:33577265-33577287 CAGGTGGAAAGGGGGTCACAAGG - Intronic
906656203 1:47549996-47550018 TAGGAGGAAATAAGGTCAGAGGG - Intergenic
908536983 1:65087518-65087540 GAGTTGGAAAGGTGGTGATATGG + Intergenic
908697658 1:66862767-66862789 TAGTGGGAAGGGAGGTGTGATGG - Intronic
909837134 1:80270433-80270455 TAATGGGAAAGGAGGCAAGAGGG - Intergenic
911178467 1:94840879-94840901 TTGTTGGGAAAGAGGTCCGAGGG + Intronic
911230845 1:95360003-95360025 TGGTAGGAAACAAGGTCAGAGGG + Intergenic
912424321 1:109573137-109573159 GATTTGTCAAGGAGGTCAGAAGG + Intronic
912575247 1:110665031-110665053 GAGTTGGAAATTAGGTCAAAAGG + Intergenic
912708309 1:111931214-111931236 TAGGTGGGAAAGAGGTGAGAAGG + Intronic
914690017 1:150017501-150017523 TAATTGGAATGCAGGTCAGGTGG + Intergenic
916320786 1:163501444-163501466 TAGTTGAAAAGGAGCACAGAGGG - Intergenic
917506607 1:175633063-175633085 TAGTTGTAAAGCAGGGAAGAGGG - Intronic
917672073 1:177282221-177282243 CTGTTGGAAAGGAGCTCTGAAGG - Exonic
918107492 1:181426813-181426835 TAGATGGGAAGGAGTTGAGATGG - Intronic
918258665 1:182774146-182774168 TAGTTTGCAAGGAAGGCAGAAGG - Intergenic
919593366 1:199531580-199531602 TTAGTGGAAAGGAGGTGAGATGG + Intergenic
919645991 1:200095103-200095125 TTATTAAAAAGGAGGTCAGATGG - Intronic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
921946334 1:220888339-220888361 GAGGTGCAAAGGATGTCAGAGGG - Intergenic
922090324 1:222389592-222389614 TGGGTGGAAAGAAGGACAGAGGG - Intergenic
923995262 1:239486570-239486592 TAGTTGCAAGAGAGGTCATATGG - Intronic
924051778 1:240086327-240086349 TAAATGAAAAGGAGGTGAGAAGG + Intronic
924303599 1:242664738-242664760 TAGCTGACAAGGAGATCAGAAGG + Intergenic
924606157 1:245537316-245537338 TAGTAGGAAAAGTGGTCTGAGGG + Intronic
924637210 1:245799454-245799476 TAATTGGAAAGGAGAAGAGAGGG - Intronic
1063677915 10:8158249-8158271 TAGCTGGAAAGGAGCTGAGAGGG - Intergenic
1063929009 10:11010395-11010417 CAGTTGGAAAGGAAGAGAGAAGG - Intronic
1063994035 10:11599958-11599980 TACTTTGAAAGTAGGTCGGAGGG - Intronic
1068049627 10:51932846-51932868 TACTTGGAAAGGAGGTGAAGCGG + Intronic
1068828431 10:61465934-61465956 TAGTTTGAAATGAGGTCATAAGG + Intergenic
1069767358 10:70872941-70872963 AAGATGGGAAGGGGGTCAGATGG + Intronic
1071474545 10:86014767-86014789 TAGTAGGAGATGAAGTCAGAGGG - Intronic
1071728795 10:88227098-88227120 TAGTTGCAAGAGAGGTCATATGG + Intergenic
1073719464 10:106150328-106150350 AAGTTGGAAAGGAAGTGATAAGG - Intergenic
1074240662 10:111635510-111635532 TTGTGTGAAAGGAGGTCAGTAGG - Intergenic
1074437194 10:113444254-113444276 CAGTGGGAAAGAAGGACAGAGGG - Intergenic
1075912141 10:126133718-126133740 TAGAGAGAAATGAGGTCAGAAGG - Intronic
1076708083 10:132313087-132313109 TGGTGGGATGGGAGGTCAGACGG + Intronic
1077581275 11:3418802-3418824 CACTTGGAACGGAGGGCAGAGGG + Intergenic
1078764250 11:14278579-14278601 TACTTGAAAAGGAAGACAGAAGG + Intronic
1080139544 11:28899444-28899466 TAGTTGGACAGTTGGGCAGATGG - Intergenic
1083115814 11:60458232-60458254 TAGGTGCACAGGAGGCCAGAAGG + Intronic
1083116773 11:60467722-60467744 TAGGTGAAAAGGAGGGAAGAGGG - Intronic
1084238197 11:67801640-67801662 CACTTGGAAAGGAGGGCAGAGGG + Intergenic
1084834213 11:71791194-71791216 CACTTGGAAAGGAGGGCAGAGGG - Intronic
1085067186 11:73507776-73507798 TATTTGGTCAGGGGGTCAGAGGG - Intronic
1086124426 11:83335562-83335584 TGGTGGGAAAGGAGCTCAAAAGG - Intergenic
1088615656 11:111625062-111625084 CAGTAGAAGAGGAGGTCAGAGGG + Intronic
1088874728 11:113925130-113925152 AGGTTGGATAGGGGGTCAGAAGG - Intronic
1089371159 11:117959152-117959174 GAGTTGGGAAGGAGTGCAGATGG + Intergenic
1089710052 11:120308089-120308111 TAGAAGGAAATGAGGTCAGATGG - Intronic
1091363917 11:135001248-135001270 TAGATGGATAGGTAGTCAGATGG + Intergenic
1091618336 12:2066852-2066874 GAGCTGGAAAGGAGGACAGGAGG + Intronic
1091961908 12:4702910-4702932 TAGCTGAAGAGGAAGTCAGAGGG + Intronic
1092698346 12:11199453-11199475 TGCTTGGTGAGGAGGTCAGATGG - Intergenic
1093764153 12:22943009-22943031 CAGTTGGAACTGAGGTCAGTGGG + Intergenic
1094412590 12:30182844-30182866 CAGTTGGAGAGGAGTTCAGCTGG + Intergenic
1094812449 12:34151689-34151711 ATGTTGGGAAGGAGGGCAGAGGG - Intergenic
1095968493 12:47885008-47885030 AAGGTGGAAAGGAGGACAGGTGG + Intronic
1096312234 12:50531427-50531449 AACCTGGAAAAGAGGTCAGAGGG + Intronic
1097929491 12:65168784-65168806 TGGTTGGAAAGGTGCTAAGAAGG + Intergenic
1098127318 12:67312097-67312119 TGGTTGGAAGGGGAGTCAGAAGG + Intronic
1098139377 12:67436066-67436088 TGCTTGGAGAGCAGGTCAGAGGG + Intergenic
1098934512 12:76462926-76462948 TAGTAGGAGATGAGGTCAGAGGG + Intronic
1098962094 12:76749269-76749291 TAGTTGGAACAGAGGCCATATGG - Intergenic
1099122248 12:78705922-78705944 TGCTTGCAAAGGAGGTCATAGGG + Intergenic
1101021068 12:100554149-100554171 TAGTTTGAAAGGAAAGCAGAAGG + Intronic
1101760082 12:107651251-107651273 AAGGAGGAAAGGAGGACAGATGG + Intronic
1102248628 12:111370601-111370623 TAGTAGGAAAATAGGTCAGCTGG + Intergenic
1102453653 12:113058064-113058086 GAGTTAGAAAGGAGGCCAGACGG + Exonic
1102745369 12:115244537-115244559 TGGTTGGGAAGGGGGTCACAGGG + Intergenic
1103445080 12:120989137-120989159 TAGATGGAAAGGAAGTCAGTGGG + Intronic
1104071934 12:125353406-125353428 TAGAGGAAAAGGAGGGCAGATGG + Intronic
1104132515 12:125908169-125908191 TAATTGGAAAGGAAGTAACAGGG + Intergenic
1104377715 12:128279537-128279559 GGGTTGAAAATGAGGTCAGAAGG - Intronic
1104878172 12:132051207-132051229 ATGTTGGAAAGGAGGTCTGCTGG + Intronic
1105652625 13:22396664-22396686 TAGTATGAGATGAGGTCAGAGGG - Intergenic
1107006731 13:35620444-35620466 TGGTTGGCAAGGAGGCCAGTGGG + Intronic
1108677152 13:52746928-52746950 TAGGTGGAGGGGAGGTGAGAGGG + Intergenic
1110449178 13:75621959-75621981 TAGGTGGAAAAGAGGTCAGTAGG + Intronic
1110710557 13:78646401-78646423 TAGTTGGGAAAGTTGTCAGAAGG + Intronic
1111654206 13:91132004-91132026 AAGCAGGAGAGGAGGTCAGATGG + Intergenic
1111848352 13:93540202-93540224 TTGCTAGAGAGGAGGTCAGAGGG - Intronic
1113084854 13:106558087-106558109 TATTTGGAAAGACTGTCAGAGGG + Intronic
1113572146 13:111365717-111365739 TGGTTGCAAAGGAAGTGAGAAGG - Intergenic
1113732999 13:112655935-112655957 CAGGTGGACAGGAGGTGAGAGGG + Intronic
1114411981 14:22509475-22509497 TAGGTGGAAAGGATGGCTGAAGG + Intergenic
1114885032 14:26838558-26838580 AAGTAGGAAAGGAGCTCAAATGG + Intergenic
1115374665 14:32661096-32661118 TAGGTAGAAAGGAGGTCAGAAGG + Intronic
1117483937 14:56174863-56174885 TAGTGGGAAAGGAGGGTAAAAGG - Intronic
1117800704 14:59441944-59441966 TACTTTGAAAGGAGAACAGAAGG - Intronic
1118763309 14:68893851-68893873 TGGTTGGAAGGGAGTTAAGAAGG + Intronic
1120471676 14:84933548-84933570 TAGTTGGAAAACTGGTTAGATGG + Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121691938 14:95884283-95884305 TGGTGGGAGAGGAGGTGAGATGG - Intergenic
1121786978 14:96669312-96669334 TAGAAAGAATGGAGGTCAGAGGG + Intergenic
1122740270 14:103868098-103868120 GAGTTGGAATGGAGGGCCGAGGG - Intergenic
1122762611 14:104040686-104040708 TACTGGGAAAGGAGGACACAAGG + Intronic
1125266704 15:37889648-37889670 TAATTGGAAATGAGGTAAAAAGG + Intergenic
1126551219 15:49931924-49931946 TAGTTGGAGTGGGGGTAAGAGGG + Intronic
1128909795 15:71503301-71503323 TGGTTGGGAAGAAGGTCAGAGGG + Intronic
1129563816 15:76599304-76599326 TTGTTGGAAAGTAGGTAAAATGG + Intronic
1129862891 15:78876509-78876531 TAGCTAGAATGGAGGTCACAGGG + Intronic
1130458916 15:84143476-84143498 TAGTTGGAAGAGAGGTAGGAGGG - Intergenic
1130887329 15:88104793-88104815 GAGATGGAAAGGAGAACAGAGGG + Intronic
1131185683 15:90272109-90272131 AAGAAGGAAATGAGGTCAGAAGG - Exonic
1133349843 16:5094087-5094109 CACTTGGAAAGGAGGGCAGAGGG + Intronic
1133438752 16:5802840-5802862 TGGTTGGATAGGTGGACAGATGG - Intergenic
1133562182 16:6960570-6960592 GAGTTTGGAAGGAGGTAAGAAGG - Intronic
1134747363 16:16598665-16598687 TATTTTGAAAGGAGTGCAGATGG + Intergenic
1134812847 16:17181955-17181977 AAGGTGGAGAGGAGGTCACATGG + Intronic
1134998108 16:18754993-18755015 TATTTTGAAAGGAGTGCAGATGG - Intergenic
1136043127 16:27595972-27595994 TGGTGGGAGAGGAGGACAGAGGG + Intronic
1137822208 16:51456980-51457002 CTGTTGGAAAGAAGTTCAGAGGG + Intergenic
1138383249 16:56618054-56618076 AAGTGGGAAAGGAGCTCTGAGGG + Intergenic
1138384407 16:56626343-56626365 GAGTGGGAAAGGAGCTCTGAGGG + Intronic
1138385506 16:56633217-56633239 GAGTGGGAAAGGAGCTCTGAGGG + Intronic
1138386064 16:56636316-56636338 GAGTGGGAAAGGAGCTCTGAGGG + Intergenic
1138388451 16:56652448-56652470 GAGTGGGAAAGGAGCTCTGATGG + Intronic
1138389309 16:56658549-56658571 GAGTGGGAAAGGAGCTCTGAGGG + Intronic
1138390548 16:56667477-56667499 GAGTGGGAAAGGAGCTCTGAGGG - Intronic
1138391109 16:56670383-56670405 GAGTGGGAAAGGAGCTCTGACGG + Intronic
1140486148 16:75295224-75295246 TAGCTGGAAATGAGGTAGGATGG - Intronic
1140601708 16:76484225-76484247 GATTTTGAAATGAGGTCAGATGG + Intronic
1142554193 17:761952-761974 AGGTGGGAAAGAAGGTCAGAGGG + Intronic
1142612436 17:1116666-1116688 CAGTTGGGAAGGAGGTAAGTCGG - Intronic
1145786073 17:27594711-27594733 TAGCGGGAAAAGAGGTCAAAGGG - Intronic
1147770912 17:42867347-42867369 GAGTGAGAAAGGAGGTGAGAGGG + Intergenic
1147951500 17:44110407-44110429 TAGTTGGCACTGTGGTCAGAGGG - Intronic
1148808706 17:50277437-50277459 AGGTTGGAAGGGTGGTCAGAAGG + Intronic
1148997475 17:51723801-51723823 CAGATGGAAAAGAGGGCAGAGGG - Intronic
1151260617 17:72913137-72913159 AAGTTAGATAGGAGGTAAGAGGG + Intronic
1151561788 17:74873614-74873636 TAATGGGAAAGGAGGTGAGGTGG - Intergenic
1151718194 17:75842258-75842280 TAGGTGGACAGTAGGTCAGATGG - Intronic
1152647602 17:81476841-81476863 TAGTTGGAATGTAGGTGTGATGG + Intergenic
1153583625 18:6599739-6599761 TAGTAGGAAATGAGGTCAGAAGG + Intergenic
1154958232 18:21280962-21280984 GAGTTGGAAAAGAGGTCTGGAGG + Intronic
1156252705 18:35366191-35366213 TAGAGGGAAAGCAGGCCAGATGG - Intergenic
1157758019 18:50235821-50235843 TAGTTGGTCAGGAGGTTACATGG - Intronic
1159106104 18:64003011-64003033 GAGATGGAAATGCGGTCAGACGG - Intronic
1159107548 18:64020472-64020494 TAGTTGGGATGGAAATCAGAAGG - Intergenic
1160327001 18:77959101-77959123 TAGTTATGAAGAAGGTCAGATGG + Intergenic
1160469656 18:79117592-79117614 TAGTTGGAAAGGAGGTCAGAGGG + Intronic
1160687408 19:443239-443261 TAGTTGGATGGGTGGACAGATGG + Intronic
1163554510 19:17984496-17984518 TAGCTGGAAGCCAGGTCAGAGGG + Intronic
1165402360 19:35609956-35609978 TAGCAGGAAAGGAAGTCACAGGG + Intergenic
1166082400 19:40452195-40452217 GAGTAGGCAAGGACGTCAGAGGG - Intronic
1167571351 19:50290867-50290889 CAGCTGGAGAGGAGGTCAGGAGG - Exonic
1168062875 19:53903225-53903247 CAGTTAGAAAGGAGCCCAGAAGG + Intronic
1168414187 19:56158567-56158589 CAGGTGGAAAGGAGGACAGTGGG + Exonic
925724134 2:6856635-6856657 TGGTTGATAAGGAGATCAGAAGG - Intronic
925937114 2:8774712-8774734 TGGTGGGAGATGAGGTCAGAAGG + Intronic
926538177 2:14140518-14140540 CAATTGGCAAGGAGGTTAGATGG + Intergenic
926700273 2:15798871-15798893 TAGTGGGAGATGAGGCCAGAAGG - Intergenic
928129247 2:28637761-28637783 GAGTGGGCAAGGAGGTGAGAAGG - Intronic
928990678 2:37230668-37230690 TAGTAAGAAAGGAGGGCCGAGGG - Intronic
929930464 2:46251652-46251674 GAGTAGGAAAGGAGGCCAGTTGG + Intergenic
931208202 2:60167852-60167874 TAGTTGGAAGGTAGGAAAGAGGG + Intergenic
932902416 2:75714627-75714649 CAATTGGAAAGGGGGTCAGCAGG + Intergenic
933368149 2:81381061-81381083 GAGGTGGAAGGGAGGTCAGATGG + Intergenic
933811561 2:86035873-86035895 TAGGAGGGAAGGAGGTGAGAAGG + Intronic
934903103 2:98176534-98176556 TAGCTGAAAAGGAAGGCAGAAGG - Intronic
935974106 2:108560390-108560412 TAGTAGGAGATGAGATCAGAGGG - Intronic
937098817 2:119253079-119253101 TAGCTGGAAAGGCGTGCAGAGGG - Intronic
938132868 2:128732289-128732311 GGCTTGGAAAGGAGGTGAGAGGG + Intergenic
939148779 2:138448374-138448396 CAGTTGGGCAGGAGATCAGAAGG + Intergenic
939487998 2:142841354-142841376 CAGTTGGAGAGGAAGCCAGAAGG - Intergenic
939892866 2:147758081-147758103 TAGTAGGAAATGAGATCAGTAGG - Intergenic
940016443 2:149111128-149111150 TAGTAGGAGGTGAGGTCAGAGGG + Intronic
941005752 2:160245264-160245286 GAGTAGGAAATGAGGTCATAGGG - Intronic
942496550 2:176546236-176546258 GAGTTGGAAAGGAGCTCAAAAGG - Intergenic
945487457 2:210414122-210414144 TAGGAAGAAAGGAAGTCAGAAGG - Intergenic
945571903 2:211478739-211478761 GAGTTAGAAAAGAGGTAAGATGG - Intronic
945698091 2:213134327-213134349 TAGTGGGAAAGGAGATTGGAAGG - Intronic
946100422 2:217315754-217315776 CAGTTGGAGAGGAGTTCAGCTGG + Intronic
946484650 2:220089347-220089369 TAGCTGGAAAGAAGGTGGGACGG - Intergenic
946511247 2:220358867-220358889 TAATTGCAAAGAAGGACAGAAGG - Intergenic
948509063 2:238450953-238450975 AAGTGAGAAAGGAGGTCACATGG - Exonic
948533409 2:238628605-238628627 GAGGTGGAAGGGATGTCAGAAGG - Intergenic
1168869925 20:1119258-1119280 TGGGTGGTAAGGAGTTCAGACGG - Intronic
1169027570 20:2383468-2383490 TAGTTGGGGAGGAGGTCAGAGGG + Intronic
1169066994 20:2699445-2699467 AAGATGGAAAGGAGGTGAGTGGG + Intronic
1170000672 20:11609847-11609869 TACCTGGAAAGCAAGTCAGAAGG + Intergenic
1170463631 20:16602297-16602319 TAGTTGGAAAGGAGGAGAGATGG + Intergenic
1171986165 20:31662712-31662734 TAGTAGAGAAGGAGGTAAGAAGG - Intergenic
1172310206 20:33912266-33912288 TAGTTGGAGTTGGGGTCAGAGGG + Intergenic
1172837887 20:37884795-37884817 TAGATGGAAATGCGGGCAGAAGG + Intergenic
1174181946 20:48680523-48680545 TGGTAGGAGACGAGGTCAGAGGG - Intronic
1174569248 20:51489361-51489383 GAGTTGAACAGGAGGTAAGAAGG + Intronic
1174744469 20:53047945-53047967 CAGTGGAAACGGAGGTCAGAAGG + Intronic
1174985153 20:55443582-55443604 AAGTTGGAAAGGAGATCTGGAGG - Intergenic
1175137588 20:56836480-56836502 TGGTTGGAAAGGAGGTAAGCTGG - Intergenic
1175422094 20:58840939-58840961 CAGGTGGAAAGGAGGTGAGAAGG + Intronic
1176949722 21:15030726-15030748 TAGGTGGTAAGGAGGGAAGAAGG + Intronic
1177348659 21:19905531-19905553 TATTTGAAAATGAAGTCAGAGGG - Intergenic
1178704964 21:34865548-34865570 TAGTTGGGAAGAAGGTCAAGGGG + Intronic
1179186186 21:39086883-39086905 GCATTGGAAAGGAGGTCAGAAGG + Intergenic
1180712658 22:17850075-17850097 TAGTGGGAAAGCAGGTGACATGG + Intronic
1181125072 22:20697307-20697329 TCCTTGGAAAGCAGCTCAGAAGG - Intergenic
1181398385 22:22636791-22636813 TCCTTGGAAAGCAGCTCAGAAGG + Intergenic
1181588180 22:23865863-23865885 TAGTTGAAAAAGAGCTCAGAAGG + Intronic
1181969235 22:26677779-26677801 CTGTTGGAAAGAAGGTCAGGAGG + Intergenic
1182310138 22:29398499-29398521 CAGTTGGAAAGGAGCTGAGCTGG + Intronic
1184350078 22:43937573-43937595 GAGTTGGAAAGGGGTACAGAGGG - Intronic
949293776 3:2496597-2496619 TGGTTGGAAAGCAGAACAGAAGG + Intronic
949298312 3:2552978-2553000 TACTTGCCAAGGAGGTCAAATGG - Intronic
950066573 3:10116350-10116372 TGGTGGGAGATGAGGTCAGAGGG + Intronic
950159558 3:10749989-10750011 TAGTTGGATAGGTGGAAAGACGG - Intergenic
950602382 3:14046007-14046029 TAGTGGGAAAGGTGGTCTAAAGG + Intronic
951670866 3:25180556-25180578 TAGGTGGACATGAGGTCAGGTGG + Intronic
951707709 3:25559856-25559878 TAGTTGGAAGGATGGACAGATGG + Intronic
951752658 3:26054699-26054721 AAGTTGAAAAGGAAATCAGATGG - Intergenic
954135900 3:48582004-48582026 TCATTGGAATGGAGGTCACATGG + Intronic
954249949 3:49359504-49359526 TATTTGGAAATAAAGTCAGATGG - Exonic
956610236 3:71115121-71115143 TAGTTGGAAAGGCAGAGAGAGGG + Intronic
956714786 3:72069407-72069429 CAGATGGAAAGGATCTCAGATGG - Intergenic
957054144 3:75431437-75431459 CCCTTGGAAAGGAGGGCAGAGGG + Intergenic
957726464 3:84073062-84073084 TATTTGGAAAGGATCTCAGAAGG - Intergenic
957881272 3:86216197-86216219 TAGTTGGAAAGTACCTCAGTCGG - Intergenic
957942839 3:87026724-87026746 GTGTTGGAATGGAAGTCAGAAGG + Intergenic
961002933 3:123386167-123386189 TAGGTGGACAGGAGGGCACAGGG + Intronic
961300694 3:125920276-125920298 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
961857890 3:129891506-129891528 TAGTTGCAAAAGAGATCATATGG + Intronic
962878013 3:139550700-139550722 CAGTTGGAAGGAAGGACAGAAGG - Intergenic
962962303 3:140321884-140321906 TCGTAGGAAAGGAGGACTGAAGG + Intronic
963121541 3:141780849-141780871 GAGTTGGAAAGGAGGGGAGAGGG + Intronic
963208587 3:142662903-142662925 TGTTTTGAAAGTAGGTCAGAAGG + Intronic
963699790 3:148610160-148610182 TTCTTGGAAAGGAGCTCATAAGG + Intergenic
963929827 3:150991965-150991987 TGGTTGGGAAGGAGGGTAGATGG + Intergenic
964112151 3:153098748-153098770 TGATTGGAAATGAGGTCAGAGGG - Intergenic
965077713 3:164001251-164001273 AAGAAGGAAAGGAGGTCAGAAGG + Intergenic
965103642 3:164333634-164333656 TAGTTGGAAAGGAGATTATGAGG + Intergenic
965505869 3:169514082-169514104 TAGGGGGAAAGGAGTTGAGATGG + Intronic
965688533 3:171330917-171330939 TATTTTGAAATGAGGTCAAACGG - Intronic
965812659 3:172607685-172607707 TAGCTGGAAAGCAGCTGAGATGG - Intergenic
966300390 3:178472719-178472741 TAGTTGCAATAGAGATCAGATGG + Intronic
966614691 3:181900753-181900775 AAGGTAGAAAGGAGGTAAGAGGG + Intergenic
967085185 3:186088491-186088513 TAGAGGGAAAGGAAGTGAGATGG - Intronic
967529586 3:190533314-190533336 TAGTTGGCAAGGATGTCACAGGG + Intronic
968736759 4:2301324-2301346 TAGCTGGAAATCAGGTCAGCGGG - Intronic
968996943 4:3951744-3951766 CACATGGAAAGGAGGGCAGAGGG + Intergenic
969218154 4:5739680-5739702 TAGTTGCAAAAGAGATCATATGG + Intronic
969757062 4:9156936-9156958 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
969817021 4:9694511-9694533 CACTTGGAAATGAGGGCAGAGGG - Intergenic
972102215 4:35435085-35435107 TAGTGGGAAAGAAGGTAATATGG - Intergenic
975957539 4:79859269-79859291 GAGTGGGAAAGGAGGTGAGAGGG - Intergenic
976473168 4:85453258-85453280 TAGTTGCAAATGAGGACAAAAGG - Intergenic
977594257 4:98861244-98861266 TAGAAAGAAATGAGGTCAGAAGG - Intergenic
979455001 4:120917131-120917153 CAGTTGAGGAGGAGGTCAGAGGG - Intronic
979990628 4:127370826-127370848 TTGTTGGCAAGGAGCTCAGCTGG - Intergenic
981427139 4:144616554-144616576 TAGCTGGGCAGGAGATCAGATGG + Intergenic
982913149 4:161171419-161171441 AAATTGGAAAGGAGATTAGAAGG - Intergenic
984607599 4:181803632-181803654 TAGTGAGCATGGAGGTCAGAGGG + Intergenic
984834164 4:184003710-184003732 TAGTAGCAATGGAGGTCATATGG + Intronic
984993829 4:185408648-185408670 AAATTGGAGAGGAGGCCAGAAGG - Intronic
987082023 5:14434179-14434201 TAGTTGAAAAGCAGCTCATATGG - Intronic
987087339 5:14483243-14483265 TAATAGGAAAGGAAGACAGAGGG + Intronic
987277345 5:16375751-16375773 TATTTGAAAAGGAGGTCATGGGG - Intergenic
988401668 5:30769309-30769331 TAGTTGGAATGCAACTCAGAAGG - Intergenic
995059288 5:107796176-107796198 GAGTAGGAAATGAGGTCAAAGGG + Intergenic
995453004 5:112323199-112323221 TAACTGGAAAGGAGGGAAGAGGG + Intronic
995954057 5:117753303-117753325 TACTTGGAGAGTAGGTCTGAAGG + Intergenic
996089327 5:119335623-119335645 TGGCTGGAAGGGAGGGCAGAAGG - Intronic
996410694 5:123155864-123155886 TATCTGGAGAAGAGGTCAGAAGG - Exonic
999777234 5:154821134-154821156 TAGTTGGGGAAGAGGTCTGATGG - Intronic
999844755 5:155467030-155467052 GAGCTGGAAAGGAAGCCAGAAGG - Intergenic
1000849098 5:166318007-166318029 GAGTTGGAAAGGAGGGGAGAGGG - Intergenic
1001776227 5:174331117-174331139 TGGTTGGAAAGAAGGACAGGTGG - Intergenic
1002301483 5:178259712-178259734 TACCTGGAAAGAAGGTGAGAGGG - Exonic
1003189611 6:3862545-3862567 TATTTGCAAAAGAGGACAGAGGG + Intergenic
1003984657 6:11423765-11423787 TTGTTGGAAATGCAGTCAGAAGG - Intergenic
1004637230 6:17480569-17480591 GAGTTGGAGAAGAGGTCACAAGG + Intronic
1006865776 6:37208033-37208055 TGGTTAGAAAGCAGATCAGAGGG + Intergenic
1007184036 6:39952312-39952334 TAGTTGCAACAGAGGCCAGATGG - Intergenic
1007364972 6:41384831-41384853 TCCTTGGAAAGGAGGTCTGATGG + Intergenic
1008641264 6:53465096-53465118 TATTGGGAAATTAGGTCAGAGGG + Intergenic
1009267039 6:61568834-61568856 TAACTAGAAAGGGGGTCAGAGGG + Intergenic
1009481470 6:64163102-64163124 TAGTTGGAAAGAAATTTAGATGG + Intronic
1009970815 6:70623918-70623940 TGGGTGTGAAGGAGGTCAGATGG + Intergenic
1010033600 6:71295214-71295236 TAGTTGGAAAGGAAAACAAATGG + Intronic
1011515437 6:88147901-88147923 GAATTGGAAAGGAGCTCAGCTGG - Intronic
1011872793 6:91917750-91917772 TACTTTGAAATGAGGGCAGAGGG + Intergenic
1014782206 6:125577125-125577147 TAGGAGGCAATGAGGTCAGAAGG + Intergenic
1015111429 6:129596225-129596247 TAGTGTGAAATGAGGTCAGAGGG - Intronic
1016799628 6:148155784-148155806 TAGTTGGGAAGGAGGAGAGTGGG - Intergenic
1017413698 6:154196725-154196747 TAATGGGAAAAGAGGTGAGAGGG - Intronic
1018372135 6:163178066-163178088 AAGTTGGAACGGAGAGCAGACGG + Intronic
1018491023 6:164293512-164293534 TAAGTGGAAAGGAGGTCATTAGG + Intergenic
1019282950 7:209721-209743 AAGTTGGAAATCAGGCCAGATGG - Intronic
1019688067 7:2393179-2393201 AAGAAGGAAATGAGGTCAGAAGG + Intergenic
1020321236 7:6940126-6940148 CACTTGGAACGGAGGGCAGAGGG + Intergenic
1020401281 7:7780332-7780354 TAGAAGGAAAGGAGGTCACTGGG - Intronic
1021590254 7:22253612-22253634 TAGATGGAAAGAAGATCAAAAGG + Intronic
1021964209 7:25901540-25901562 TAGTTTGAAAGGAGGTAGGTAGG - Intergenic
1022296952 7:29064602-29064624 TCTTTGGAAAGAAGGTCAAATGG + Intronic
1022609340 7:31853650-31853672 TATTTGGACAGGAGGAGAGAAGG + Intronic
1023815201 7:43944034-43944056 GAGTTGGGAAGGAGGCCAGAGGG + Intronic
1024643011 7:51346863-51346885 CAGTTGGAAAAGGGGTCAGGAGG + Intergenic
1025229117 7:57188204-57188226 TAGTAGGAAAGAGGGTGAGAGGG - Intergenic
1027831160 7:83179459-83179481 TAGTTGGAAAGGAAGCCATGAGG + Intergenic
1028135995 7:87223479-87223501 TAATTGGAAAGGAGGAGAAATGG - Intergenic
1028244104 7:88455107-88455129 AAGAAGGAAAGGTGGTCAGAAGG + Intergenic
1028494183 7:91445671-91445693 TAGTAGGACATGAGGCCAGAAGG - Intergenic
1029881863 7:103821753-103821775 TAGTTGCAAAGGAGCAAAGATGG - Intronic
1030126363 7:106156211-106156233 TAGTTGCAGGGGAGATCAGAGGG + Intergenic
1030733130 7:113013768-113013790 TAATTGTAAAGAAGCTCAGAAGG - Intergenic
1031239971 7:119225038-119225060 TAGTTGGTATGGAGATCATATGG - Intergenic
1032158887 7:129495077-129495099 TAGTTGTAAAAGAGGACACAGGG + Intergenic
1033606344 7:142930814-142930836 TAGTTGGAGAGCGGGACAGAGGG + Intronic
1033845964 7:145432589-145432611 CAGCTGGATAGTAGGTCAGATGG - Intergenic
1034694973 7:153045012-153045034 AAGCTGGAAAGGAGTTTAGAAGG - Intergenic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035635420 8:1140316-1140338 CAGATGGAAGGGAGGCCAGAGGG - Intergenic
1036380292 8:8232251-8232273 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
1036849268 8:12190409-12190431 CACTTGGAACGGAGGGCAGAGGG + Intronic
1036870628 8:12432683-12432705 CACTTGGAACGGAGGGCAGAGGG + Intronic
1037510900 8:19581345-19581367 TAATTGCAAAGTAGGTGAGAGGG - Intronic
1039006062 8:33038461-33038483 TAATTGGCACTGAGGTCAGATGG + Intergenic
1039025746 8:33256040-33256062 TAGTTGCAAAAGAGATCATATGG + Intergenic
1040681468 8:49815785-49815807 TACCTGGAAAGACGGTCAGATGG + Intergenic
1042121697 8:65495445-65495467 TTGTTGGGAAGGAGCCCAGATGG + Intergenic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1043037755 8:75219021-75219043 TAGTTGGAAAGAAGGAAGGAAGG + Intergenic
1043061222 8:75506594-75506616 GAATTAGAAAGGAGGTCAAAGGG - Intronic
1043083436 8:75796347-75796369 AGGTTGGAGATGAGGTCAGATGG - Intergenic
1043199717 8:77351376-77351398 TAGTTGGAATGGAGATAAGATGG - Intergenic
1044964571 8:97562642-97562664 GAATTGGGAGGGAGGTCAGAGGG - Intergenic
1045181322 8:99786158-99786180 TGGGTGGAGAGGAGGTCAGCAGG + Intronic
1045206840 8:100051263-100051285 TGGTAGGAAATGAAGTCAGAGGG + Intronic
1046328928 8:112688035-112688057 TAGTTGCAAAGGAGATCGTATGG - Intronic
1046453414 8:114423789-114423811 TAGTTTCAAATGAGCTCAGATGG - Intergenic
1047177094 8:122552302-122552324 CGGTTGGAAGGGAGGTCAGTTGG - Intergenic
1049241858 8:141541856-141541878 TGGTGGGACAGGAGGGCAGAGGG - Intergenic
1050228432 9:3489315-3489337 TAGGTGGGAAGGGTGTCAGAGGG - Intronic
1050527668 9:6560139-6560161 CAGTGGGAAAGTAAGTCAGAAGG + Intronic
1053837636 9:42157891-42157913 AAGATGGAAAGTAGGTCAAAAGG + Intergenic
1053883393 9:42618273-42618295 AAGATGGAAAGTAGGTCAAAAGG - Intergenic
1053889276 9:42676026-42676048 AAGATGGAAAGTAGGTCAAAAGG + Intergenic
1054222416 9:62425740-62425762 AAGATGGAAAGTAGGTCAAAAGG - Intergenic
1054228297 9:62483432-62483454 AAGATGGAAAGTAGGTCAAAAGG + Intergenic
1055416171 9:76085898-76085920 CACTTGGAAAGGAGGATAGAGGG - Intronic
1060186494 9:121567081-121567103 TAGTTGGAAAAGCCGCCAGATGG + Exonic
1061203756 9:129151518-129151540 TAGTTGCAAAGGAGGGCGGAAGG + Intergenic
1061367088 9:130177737-130177759 GAGTTGGAAGGCAGGTCTGAAGG - Intronic
1062100659 9:134726707-134726729 TAGATGGATAGGTGGACAGATGG + Intronic
1188629204 X:32330519-32330541 CAGCTGGAAGGGAGCTCAGATGG - Intronic
1190153484 X:47967737-47967759 TTGTTGGAAATGAGGTCTGGTGG + Intronic
1190245435 X:48687654-48687676 TAGATGGAAAGGTGGGCACATGG + Intronic
1190914514 X:54800659-54800681 TAATAGGAAATGGGGTCAGATGG - Intergenic
1192774141 X:74224035-74224057 AAATGGGAAAGGAGGTCAAACGG + Intergenic
1192840274 X:74848274-74848296 TAGCTGGCAAGGAAGCCAGATGG + Intronic
1194671094 X:96733482-96733504 TAGTAGGAGATGAGGTCAGAGGG + Intronic
1195276871 X:103289784-103289806 TAATTGGAAATTAGGTCATAAGG + Intergenic
1195669122 X:107454298-107454320 TGGTTGGTAAAGAGGTGAGAAGG - Intergenic
1196409831 X:115406532-115406554 GAGTTGGAAAATAGGTCAAATGG - Intergenic
1196624702 X:117864958-117864980 TAGTATAAAAGGAAGTCAGAGGG - Intergenic
1197149223 X:123202289-123202311 AAGTTGAAAAGGTTGTCAGATGG - Intronic
1197813758 X:130475609-130475631 TACCTGGAAAGGAGGTGAGCAGG + Intergenic
1198054986 X:132984995-132985017 TCATTGGAAAGCAGGCCAGAAGG - Intergenic
1198055465 X:132990448-132990470 TAGCTGGGAATGAGGTCTGAGGG + Intergenic
1199848364 X:151707800-151707822 TAAGTGGAAATGAGGTCAGTGGG - Intergenic
1201607518 Y:15803413-15803435 CACTTGCAAAGGATGTCAGAAGG + Intergenic