ID: 1160476151

View in Genome Browser
Species Human (GRCh38)
Location 18:79190114-79190136
Sequence GGGTTTGATACTGCATCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160476148_1160476151 18 Left 1160476148 18:79190073-79190095 CCGGGAGCACAGTGTGTACTGCA 0: 1
1: 0
2: 1
3: 21
4: 216
Right 1160476151 18:79190114-79190136 GGGTTTGATACTGCATCTTCAGG 0: 1
1: 0
2: 0
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160476151 Original CRISPR GGGTTTGATACTGCATCTTC AGG Intronic
902895148 1:19474580-19474602 GGGTTTGATATTTCATTTTAAGG - Intronic
905383705 1:37584012-37584034 GGGTTTGATACTGTTTTTTTTGG - Intronic
906274935 1:44508299-44508321 GGGTTTGCTAGTGCATCTCCAGG + Intronic
907342513 1:53746461-53746483 GTTTTTGACAGTGCATCTTCAGG - Intergenic
919115637 1:193277203-193277225 GGGTTTTATAGAGCATCTTGAGG + Intergenic
1063575041 10:7254034-7254056 GGGTTTGCCACTGAAACTTCTGG + Intronic
1068300820 10:55136250-55136272 GGGTTAGATACTACATTTGCTGG + Intronic
1071539816 10:86470333-86470355 TAATTTAATACTGCATCTTCTGG - Intronic
1083342111 11:61965328-61965350 GGGTGTCATACTTCATCATCTGG - Exonic
1085109783 11:73877204-73877226 GGGTTTGATACTTCTTTTTCCGG - Intronic
1090977284 11:131688689-131688711 GAGCTTGATGCTGCTTCTTCAGG + Intronic
1090996263 11:131868509-131868531 GGGTTTGATTCTGCAGCTGCTGG - Intronic
1092189156 12:6505536-6505558 TGATTTAATACTGCATCTTTAGG + Intronic
1095262442 12:40112082-40112104 TGGTTTGAGACTGGTTCTTCAGG + Intergenic
1095995008 12:48074503-48074525 GGCTCTGATACTTCATCATCTGG - Exonic
1100841925 12:98621296-98621318 GGTTTTGCCACTGCATATTCTGG - Intronic
1101523722 12:105508138-105508160 GGGTTTGATACGTTATGTTCTGG + Intergenic
1110784837 13:79511577-79511599 GTGTGTGATACTGAATCTTGAGG + Intronic
1111291394 13:86175295-86175317 GGCTTTGATTCTGCCTCTTCTGG + Intergenic
1111867531 13:93788224-93788246 TGCGTTGATACTGCATCTTCTGG + Intronic
1113080639 13:106516259-106516281 GGGTCAGAAACTGCATCTGCAGG - Intronic
1116397394 14:44463006-44463028 GGGTTTGGTACTGAGTTTTCAGG - Intergenic
1116484288 14:45428050-45428072 GGGTTTTATTCTTCCTCTTCTGG + Intergenic
1120588676 14:86348315-86348337 GGGTTTGGTAATGTATTTTCTGG + Intergenic
1121669577 14:95697871-95697893 GGGTTTGTTGCTGCAGCTTTGGG - Intergenic
1129807278 15:78473464-78473486 GGGTTCATTACTGCATCCTCAGG + Intronic
1133686125 16:8167074-8167096 GGGTTTGGTTCTGAATCTGCAGG - Intergenic
1134352821 16:13453616-13453638 GGGCTCGTTCCTGCATCTTCAGG - Intergenic
1137465061 16:48700277-48700299 GGGTCTGAAAGTGCATCTTGAGG + Intergenic
1138819656 16:60243679-60243701 GGGATTCATATTGCACCTTCTGG + Intergenic
1139933686 16:70551252-70551274 GGGTATGAGACTGTATCTTTAGG - Intronic
1146006430 17:29163458-29163480 GGGTTTGCTACTGTGTCCTCTGG + Intronic
1147570844 17:41569900-41569922 GAGTCTCATACTGCATCTCCAGG + Exonic
1148219569 17:45851960-45851982 GGGTTTAGTACTGGAGCTTCTGG + Intergenic
1150343906 17:64389348-64389370 GGGTTTTGTTCTGCTTCTTCTGG - Intronic
1153202931 18:2664209-2664231 TGGTTTGATAATACATATTCAGG - Intronic
1153397246 18:4638086-4638108 GGGTTTGCTTCTGCTTCTTACGG + Intergenic
1160476151 18:79190114-79190136 GGGTTTGATACTGCATCTTCAGG + Intronic
1162609952 19:11741647-11741669 GGCCTTCTTACTGCATCTTCTGG + Intergenic
1166074389 19:40405239-40405261 AGGTTTGTCACTGCCTCTTCTGG - Intronic
1166164997 19:40981103-40981125 GGGTTTTCTCTTGCATCTTCAGG + Intergenic
930748870 2:54913116-54913138 GGGTGTGAGACAGCATCTTGTGG + Intronic
931808922 2:65835049-65835071 GTATTTTATACTGTATCTTCAGG - Intergenic
933021876 2:77204565-77204587 AGGTTTGATGCTGTTTCTTCAGG + Intronic
937313655 2:120917477-120917499 GGGCAGGGTACTGCATCTTCAGG - Intronic
1171257144 20:23697995-23698017 GGGGTTTATGCTGCATTTTCTGG + Intergenic
1171274298 20:23842510-23842532 GGGGTTTATGCTGCATTTTCTGG + Intergenic
1174609939 20:51790721-51790743 GGGTGCGATAATGCATCTTGAGG + Exonic
1179060876 21:37978158-37978180 GGGTGTGAAATTGCATCTTGTGG - Intronic
1179225833 21:39452109-39452131 GTGTTTGTTGCTACATCTTCTGG + Exonic
1183809277 22:40240348-40240370 GGGTTTAATATTGCCTCTGCAGG - Intronic
1183967030 22:41448000-41448022 GGGCTCCAGACTGCATCTTCCGG - Intergenic
1185415439 22:50706743-50706765 GGGTTTGATGGGGCATGTTCTGG + Intergenic
950188088 3:10957693-10957715 GGGTTTGGAACTGCATCTGGTGG - Intergenic
961859873 3:129907441-129907463 GGGTTTTGTATTGCATCTCCTGG - Intergenic
961969832 3:130950335-130950357 GGGTTTAATACTTAAACTTCTGG + Intronic
963695022 3:148555637-148555659 GAGTTTGTTACTGTATCTTTAGG + Intergenic
963716613 3:148811299-148811321 TTGTTTTCTACTGCATCTTCAGG - Intronic
972730509 4:41790015-41790037 GGGCTTCATAGTGCATCTTAAGG - Intergenic
976764066 4:88580637-88580659 GGGTTTGATTTTGGGTCTTCAGG + Intronic
977017358 4:91708130-91708152 GCCTTGGATACTGCATCCTCTGG + Intergenic
980189505 4:129505922-129505944 GGATTTGATTCTGTATCTTCAGG - Intergenic
980397439 4:132232715-132232737 GCCTTTGATTCTGCACCTTCAGG + Intergenic
984009885 4:174357975-174357997 GGTTATGATACTGCTTCCTCAGG + Intergenic
986179788 5:5382914-5382936 GGCTTTGTTGCTGCATCCTCAGG - Intergenic
987875947 5:23681327-23681349 AGTATTTATACTGCATCTTCAGG - Intergenic
994122258 5:96128820-96128842 GGGATGGATACTGCTTCCTCAGG + Intergenic
994552729 5:101258364-101258386 TTCTTTTATACTGCATCTTCAGG - Intergenic
996493484 5:124126715-124126737 GGGTTTGAGACTGCTACTGCTGG - Intergenic
1000099521 5:158001893-158001915 TGGTTTGTTACTGCATCTCTAGG + Intergenic
1008638473 6:53436352-53436374 GGGTTTGATTATGCCCCTTCTGG + Intergenic
1011233557 6:85190222-85190244 GAGTTTGAAACTTAATCTTCTGG - Intergenic
1015398789 6:132765161-132765183 ATGCTTGCTACTGCATCTTCTGG - Intergenic
1019177603 6:170168137-170168159 GGGGTTGTTACTGCCTGTTCCGG + Intergenic
1019177659 6:170168517-170168539 GGGGTTGTTACTGCCTGTTCGGG + Intergenic
1019177679 6:170168637-170168659 GGGGTTGTTACTGCCTGTTCGGG + Intergenic
1019177741 6:170168953-170168975 GGGGTTGTTACTGCCTGTTCGGG + Intergenic
1019177755 6:170169032-170169054 GGGGTTGTTACTGCCTGTTCGGG + Intergenic
1019177806 6:170169331-170169353 GGGGTTGTTACTGCCTGTTCGGG + Intergenic
1019177814 6:170169371-170169393 GGGGTTGTTACTGCCTGTTCGGG + Intergenic
1019177873 6:170169688-170169710 GGGGTTGTTACTGCCTGTTCGGG + Intergenic
1019177897 6:170169828-170169850 GGGGTTGTTACTGCCTGTTCGGG + Intergenic
1019177926 6:170169988-170170010 GGGGTTGTTACTGCCTGTTCGGG + Intergenic
1019177934 6:170170028-170170050 GGGGTTGTTACTGCCTGTTCGGG + Intergenic
1019178048 6:170170648-170170670 GGGGTTGTTACTGCCTGTTCGGG + Intergenic
1019178117 6:170171006-170171028 GGGGTTGTTACTGCCTGTTCGGG + Intergenic
1019178142 6:170171146-170171168 GGGTTTGTTACTGCCTGTTTGGG + Intergenic
1019178230 6:170171666-170171688 GGGGTTGTTACTGCCTGTTCGGG + Intergenic
1021687362 7:23200230-23200252 GGATTTGCTGCTGCCTCTTCTGG + Exonic
1028933086 7:96435990-96436012 GGTTTGGATACTCCATCTTGTGG + Intergenic
1033423339 7:141221703-141221725 GGGTTTGATCCTGGATTTTGGGG + Intronic
1036400134 8:8400674-8400696 GGGCTTGTTGCCGCATCTTCGGG - Intergenic
1045823185 8:106365951-106365973 GGGTTTGAACCTGCAACCTCAGG - Intronic
1051420484 9:16884238-16884260 GGCTGAGATACTGGATCTTCGGG + Intergenic
1055254268 9:74348553-74348575 GTGTTTTATAATGCATCTTCTGG - Intergenic
1057153843 9:92821373-92821395 GTGTTAGAGGCTGCATCTTCTGG - Intergenic
1058739127 9:107924799-107924821 GGGACTGACACTGCATCTCCTGG - Intergenic
1060579274 9:124729660-124729682 GTTTTTGATACTGCATATTCTGG - Intronic
1189808077 X:44754871-44754893 TGCTTTGTTGCTGCATCTTCTGG - Intergenic
1190582783 X:51904379-51904401 GGGTTTGGGGCTGCATCTTTGGG + Intergenic
1194236546 X:91391045-91391067 CGATTTAATACTGCATCTTTAGG - Intergenic
1195802917 X:108733772-108733794 GGCTTTGAAGCTGCATCTTTGGG + Exonic
1199045101 X:143160782-143160804 GGATGTGATACTGCAGCATCAGG - Intergenic
1200909017 Y:8514652-8514674 GGGTTTGACAATCCAACTTCAGG - Intergenic
1202195746 Y:22297233-22297255 GGGTTTGACAATCCAACTTCAGG + Intergenic