ID: 1160478438

View in Genome Browser
Species Human (GRCh38)
Location 18:79216005-79216027
Sequence TCTAATGTATGTACAGTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 220}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160478437_1160478438 -6 Left 1160478437 18:79215988-79216010 CCACAAAACTAGAACATTCTAAT 0: 1
1: 0
2: 3
3: 22
4: 345
Right 1160478438 18:79216005-79216027 TCTAATGTATGTACAGTTCTAGG 0: 1
1: 1
2: 0
3: 22
4: 220
1160478435_1160478438 -1 Left 1160478435 18:79215983-79216005 CCCGACCACAAAACTAGAACATT 0: 1
1: 0
2: 1
3: 20
4: 171
Right 1160478438 18:79216005-79216027 TCTAATGTATGTACAGTTCTAGG 0: 1
1: 1
2: 0
3: 22
4: 220
1160478434_1160478438 4 Left 1160478434 18:79215978-79216000 CCGCACCCGACCACAAAACTAGA 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1160478438 18:79216005-79216027 TCTAATGTATGTACAGTTCTAGG 0: 1
1: 1
2: 0
3: 22
4: 220
1160478433_1160478438 7 Left 1160478433 18:79215975-79215997 CCACCGCACCCGACCACAAAACT 0: 1
1: 0
2: 24
3: 246
4: 1678
Right 1160478438 18:79216005-79216027 TCTAATGTATGTACAGTTCTAGG 0: 1
1: 1
2: 0
3: 22
4: 220
1160478436_1160478438 -2 Left 1160478436 18:79215984-79216006 CCGACCACAAAACTAGAACATTC 0: 1
1: 0
2: 1
3: 10
4: 216
Right 1160478438 18:79216005-79216027 TCTAATGTATGTACAGTTCTAGG 0: 1
1: 1
2: 0
3: 22
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160478438 Original CRISPR TCTAATGTATGTACAGTTCT AGG Intronic
902178387 1:14668921-14668943 TCTATTCTATGTACTGCTCTGGG - Intronic
902306166 1:15541112-15541134 TATAATGTATATAAAGCTCTAGG + Intronic
904085847 1:27907354-27907376 TCTAATATATTTAAAGTACTTGG - Intronic
907163120 1:52386157-52386179 TCTAATGTATGTATAGTATCAGG + Intronic
908265267 1:62372580-62372602 ACTACTGTATGTACTTTTCTGGG + Intergenic
908738375 1:67300984-67301006 TTTACTGTATGTAAAATTCTAGG - Intergenic
909349138 1:74629052-74629074 GCTAATATATGTTCAGTTTTGGG - Intronic
909850491 1:80456054-80456076 TCCATTGTATCTACAGTGCTAGG + Intergenic
910035683 1:82784628-82784650 TGTAATGTATGTGAAGGTCTTGG + Intergenic
910302872 1:85727393-85727415 CCTAATGGGTGTAAAGTTCTGGG + Intergenic
917750704 1:178050762-178050784 ACTAATGTATGTAAAGTGCCTGG + Intergenic
918157691 1:181865520-181865542 TCTAATGTTTTTATAGTTTTAGG - Intergenic
918465277 1:184815421-184815443 TCCAATGGGTGTACAGTTCCAGG - Intronic
919263723 1:195234592-195234614 GATAATGTATGTATATTTCTTGG + Intergenic
921827332 1:219687932-219687954 TCTGATGTATGCACATTTCCAGG - Intronic
924640846 1:245832060-245832082 TCTAATGAATGGGCAGGTCTGGG + Intronic
1063817782 10:9795942-9795964 TCTATTGAATGAACAGTTCCTGG + Intergenic
1066215989 10:33288151-33288173 TCAAATGTATGTCCAGGTATTGG + Intronic
1066649631 10:37642386-37642408 ACTACTGAATGTAGAGTTCTAGG - Intergenic
1068083845 10:52349728-52349750 ACAAAACTATGTACAGTTCTGGG - Intergenic
1068625135 10:59236555-59236577 GCTACTGTATATTCAGTTCTTGG - Exonic
1069773331 10:70912949-70912971 GCTAATGTATGGAAAGTGCTCGG + Intergenic
1070030831 10:72675626-72675648 TCTAATGTCTATACATTGCTTGG - Intergenic
1071391514 10:85179937-85179959 AATAATGCATGTAAAGTTCTTGG + Intergenic
1073371717 10:102995556-102995578 TCTATTATATGTAGAGTTTTTGG + Intronic
1073969770 10:109034114-109034136 TCCAATTTATGCACAGTTATAGG + Intergenic
1074634535 10:115298803-115298825 CCTACTATATGTACAGTACTTGG + Intronic
1074677832 10:115872242-115872264 TCTAATGTATGCACAATTTGTGG + Intronic
1075328625 10:121555435-121555457 TCTAAGGTATATAAAGTTCAGGG - Intronic
1075652241 10:124135346-124135368 TCTACTATATGTACTGTTCTAGG - Intergenic
1076210312 10:128635989-128636011 TCTCATATATGTACAGATGTAGG - Intergenic
1079195243 11:18321019-18321041 TATACTGTTTGTACATTTCTAGG - Intronic
1080121485 11:28683098-28683120 TCTATTGCAGGCACAGTTCTAGG + Intergenic
1081081157 11:38740855-38740877 TCTAAGGTTTTTATAGTTCTAGG + Intergenic
1081738669 11:45423043-45423065 AGTAATGTATGTAGAGTGCTTGG + Intergenic
1081908262 11:46682876-46682898 GCTAATGTATGTGAAGTGCTTGG - Intronic
1082660727 11:55907710-55907732 ATTAATGTATTTACAGTTTTTGG + Intergenic
1082698399 11:56399123-56399145 TCCAATGGGTGTACAGTTCCAGG + Intergenic
1082843349 11:57707485-57707507 CCTAATGTGTGTACTGTGCTGGG - Intronic
1085813748 11:79712993-79713015 TCTAAGGTTTGTATAGTTTTAGG + Intergenic
1086534005 11:87821339-87821361 TCTAATGAGTGTAGAATTCTAGG - Intergenic
1086573100 11:88307137-88307159 TCTAATATCTGTAGAGTTCATGG - Intronic
1086840387 11:91676839-91676861 GCTAATGGATGTACCTTTCTGGG - Intergenic
1086939832 11:92783806-92783828 TTTACTGTATGTATAGATCTGGG + Intronic
1087226945 11:95611820-95611842 TCCAATGTATGTACAGTTCTAGG + Intergenic
1087509620 11:99074420-99074442 TCTAGGGTTTCTACAGTTCTAGG - Intronic
1090327249 11:125899770-125899792 GCTGATGAATGTACAGTTCCAGG + Exonic
1090421091 11:126575429-126575451 GATAATGTATGTACAATACTGGG + Intronic
1091809852 12:3387647-3387669 GATAATGCATGTAAAGTTCTTGG - Intronic
1095238478 12:39828372-39828394 TCTAATTTATGTGCAGTTACAGG + Intronic
1095548775 12:43407384-43407406 CATAATGGATTTACAGTTCTTGG + Intronic
1098824539 12:75278233-75278255 TCTAAATTATGTACTGTTGTTGG - Intronic
1099644922 12:85340903-85340925 TTTAATGGATGTAAACTTCTTGG - Intergenic
1099813439 12:87615657-87615679 TGTCATTTATGGACAGTTCTAGG - Intergenic
1100289782 12:93202729-93202751 TTTACTGTATCTACAGTACTTGG + Intergenic
1101189368 12:102315459-102315481 TCCAATGGGTGTACAGTTCCAGG - Intergenic
1101655254 12:106714496-106714518 CCTAATGCATGTAAATTTCTAGG - Intronic
1102810918 12:115823595-115823617 TCTAAAGATTGCACAGTTCTTGG + Intergenic
1103337112 12:120198076-120198098 ATTAATGGATGTACAGTGCTGGG - Intronic
1107282413 13:38751645-38751667 TATAATGTATGTATAGTATTTGG + Intronic
1109218240 13:59614598-59614620 TCTAATCTAGGTCCATTTCTAGG - Intergenic
1110050125 13:70886520-70886542 TCCAATGGGTGTACAGTTCCAGG - Intergenic
1110829317 13:80012219-80012241 TATAATGCATGTACAGCACTTGG - Intergenic
1112053186 13:95664487-95664509 TCCATTGTATGCACAGTTCTCGG + Intergenic
1112244401 13:97717502-97717524 TCTAATGTTTGTATAGTTTTAGG - Intergenic
1112689311 13:101871919-101871941 TCTAATATATGTAGATCTCTGGG - Intronic
1115482942 14:33879968-33879990 TTTAATGGATGTAGAGTTTTAGG + Intergenic
1118054132 14:62061393-62061415 TTTAATGTATGAACATTGCTAGG - Intronic
1119146659 14:72321885-72321907 TCTAAAGTATAGTCAGTTCTGGG - Intronic
1119308312 14:73625726-73625748 TCTTATGTGGGTGCAGTTCTGGG - Intergenic
1119466759 14:74864323-74864345 ATTAATGGATGTAGAGTTCTTGG - Intronic
1123913984 15:25002065-25002087 TCTGATGTTTGTACAGCTTTAGG - Intergenic
1125900880 15:43345933-43345955 TCTACTGAGGGTACAGTTCTTGG + Exonic
1128419799 15:67480802-67480824 CCTAATGTACCTACAGCTCTAGG + Intronic
1131501217 15:92968536-92968558 TCTAATGAATTAACAGATCTAGG - Intronic
1135511358 16:23086838-23086860 TGTAATTTATCTACAGTCCTAGG + Intronic
1135784643 16:25337900-25337922 TTTTTTGGATGTACAGTTCTGGG + Intergenic
1137843956 16:51668762-51668784 TCTAATTCATGGACAGTTGTTGG + Intergenic
1139298011 16:65919615-65919637 TCTAATGTATCTTCATTTCAGGG + Intergenic
1141475918 16:84273292-84273314 TCTATTGCATGTTCAGCTCTAGG + Intergenic
1143302308 17:5919614-5919636 TGTAATTTATGTACACCTCTGGG - Intronic
1146767304 17:35535008-35535030 GATAATGTATGTAAAGTTTTTGG - Intronic
1146793348 17:35765178-35765200 ACAAATGTTTGTACCGTTCTGGG - Intronic
1147293183 17:39460388-39460410 GATAATGTATGTAAAATTCTTGG + Intergenic
1149392153 17:56202756-56202778 TCTAATATATGGACACTTCATGG - Intronic
1151122978 17:71813527-71813549 TCCAGGGTTTGTACAGTTCTAGG - Intergenic
1153971708 18:10233309-10233331 TCTAATGTATGGAAATTTCACGG + Intergenic
1155545049 18:26906143-26906165 TTTGATGTATGTACATTTATTGG + Intergenic
1155754451 18:29472943-29472965 TCTAATGTATTAATACTTCTTGG - Intergenic
1156322012 18:36035356-36035378 GATAATGTATGTAAAGTGCTTGG - Intronic
1157147600 18:45180352-45180374 TCTAATGTACTTAAAATTCTTGG + Intergenic
1157784065 18:50466533-50466555 CATAATTTATGGACAGTTCTAGG - Intergenic
1160478438 18:79216005-79216027 TCTAATGTATGTACAGTTCTAGG + Intronic
1165190018 19:34055073-34055095 TCTGATGTTTGTACAGTTTTAGG - Intergenic
925535023 2:4907299-4907321 AATAATGTATGTAAATTTCTTGG - Intergenic
926589188 2:14721534-14721556 TATAATGTATGTAAAGTTCCTGG - Intergenic
927365583 2:22291944-22291966 TCTAATTTATGTACATTCATAGG + Intergenic
929627670 2:43426746-43426768 TCTTATGTATGTAGTGTCCTAGG - Intronic
931024340 2:58092271-58092293 TGTAAGGTATGTACTGTTTTGGG + Intronic
931731078 2:65154006-65154028 TCTACTGGAGGCACAGTTCTGGG - Intergenic
932627526 2:73309458-73309480 TCTAATGTATGTCAAGCCCTGGG - Intergenic
932821342 2:74903870-74903892 TGTAATGGATGTACTGATCTAGG + Intergenic
933193490 2:79363475-79363497 TTTAACGTATGTAAAGTGCTTGG + Intronic
933519970 2:83359244-83359266 TCTGATGTATATACAAATCTGGG - Intergenic
934911361 2:98257967-98257989 TCTAATATGTTTACAGTTTTAGG + Intronic
940097182 2:149990355-149990377 TCTAATGTATGATCAGATTTTGG + Intergenic
940897423 2:159094311-159094333 TCTTTTGTATGTAATGTTCTGGG + Intronic
941259875 2:163284333-163284355 TCTAAAGTATTCACTGTTCTAGG - Intergenic
943725606 2:191248197-191248219 AGTAATGTATGTAAAATTCTTGG - Intronic
943786108 2:191880732-191880754 TCTGTTGTATGATCAGTTCTTGG - Intergenic
944706301 2:202292347-202292369 TATAATGTATGTAAACTACTTGG - Intronic
946052236 2:216872978-216873000 TTTACTATATGTACATTTCTTGG - Intergenic
1169065209 20:2691341-2691363 TGTAATGTGTGTACAGGTCTTGG + Intergenic
1177140036 21:17348054-17348076 GCTCATGTGTATACAGTTCTTGG + Intergenic
1177356490 21:20014872-20014894 TATACTGTATGGAAAGTTCTAGG + Intergenic
1181927670 22:26373157-26373179 GCAAATGTATGTAGAGTTCTTGG + Intronic
950604825 3:14069326-14069348 TCCAATGGGTGTACAGTTCCAGG + Intronic
952868535 3:37875846-37875868 TCTAATGTATGAGCACTTATTGG + Intronic
953147013 3:40287723-40287745 TGAAATTTATGTACAGTTTTGGG + Intergenic
955117050 3:56016318-56016340 TCTAGAGTTTTTACAGTTCTGGG + Intronic
955412401 3:58664209-58664231 GCTAATCCATGTACAGTACTTGG + Intronic
955536031 3:59924582-59924604 ACTAATTCTTGTACAGTTCTAGG - Intronic
956954953 3:74327051-74327073 TATGATGTATGTACATTTCCTGG + Intronic
957395576 3:79632666-79632688 TCCACAATATGTACAGTTCTAGG - Intronic
958092067 3:88889560-88889582 ACTAAGGTATGTACATTTTTTGG + Intergenic
960605623 3:119501928-119501950 TCTAATTTAATTTCAGTTCTAGG - Intronic
962544147 3:136414990-136415012 TCTTATGTGGGTACAGTTCATGG + Intronic
962682245 3:137812532-137812554 TCTGATGAATGTAGAATTCTAGG + Intergenic
963593112 3:147287466-147287488 TTTAATGGATTTACAGTTCCAGG + Intergenic
964091048 3:152875951-152875973 TTTAATATATGTAAAGCTCTTGG - Intergenic
966005483 3:175006388-175006410 TCTGTTATTTGTACAGTTCTGGG - Intronic
966435700 3:179881544-179881566 TCTAATGTATGTAAAGTGCCAGG + Intronic
967407186 3:189130137-189130159 CATGATGTATGTACAGATCTTGG + Intronic
967688200 3:192441985-192442007 TAAAATGTATGTACAATTGTTGG - Intronic
968847046 4:3049549-3049571 TCCAATGGGTGTACAGTTCCAGG + Intergenic
970031575 4:11681602-11681624 TCTATAGTGTGTACATTTCTGGG - Intergenic
972819155 4:42679616-42679638 TCCAATGGGTGTACAGTTCCAGG - Intergenic
973813909 4:54600622-54600644 TCCAATGGGTGTACAGTTCCAGG + Intergenic
974516072 4:62912871-62912893 TGTAATGTATGTATATATCTGGG - Intergenic
974978039 4:68916607-68916629 TATAATGTATTTAAAATTCTAGG - Intergenic
974987225 4:69042889-69042911 TATAATGTATTTAAAATTCTAGG + Intronic
977280060 4:95028872-95028894 TCTAATTAATGTACAATGCTTGG - Intronic
977530675 4:98196800-98196822 AATAATGTGTGTAAAGTTCTTGG + Intergenic
979032988 4:115676228-115676250 TCTGATGTTTGTACAGCTTTAGG + Intergenic
979472721 4:121120304-121120326 TATACTGTATGTACAGTGATGGG - Intergenic
980476926 4:133330365-133330387 TTTATTGTATGTTAAGTTCTGGG + Intergenic
980512757 4:133814755-133814777 TCTAGTGTTTTTACAGTTTTGGG - Intergenic
980547833 4:134292474-134292496 ACTAATTTATGTAAAGTCCTTGG - Intergenic
980607861 4:135116391-135116413 TTTAATGTATGCACAGGGCTGGG - Intergenic
980689673 4:136279150-136279172 TCTAATCTTTTTAAAGTTCTAGG + Intergenic
980708721 4:136535626-136535648 TCTATTTTAAGTACTGTTCTAGG + Intergenic
981329022 4:143486680-143486702 TTCAATGTATGTACACATCTAGG + Intergenic
981596930 4:146435047-146435069 CCTACTGTATGCTCAGTTCTGGG - Intronic
982390156 4:154854791-154854813 TTTATTGCATGTATAGTTCTTGG + Intergenic
982565191 4:156977129-156977151 TTTAATGAATCTACAGTTCCTGG - Intergenic
982782173 4:159502651-159502673 TCTAAATTATGTAAAGTCCTTGG - Intergenic
984482507 4:180323946-180323968 TCTAGTGTATTTATAGTTTTGGG + Intergenic
985242426 4:187944813-187944835 TGTAATATATGTACAGGGCTTGG + Intergenic
987208481 5:15653078-15653100 TCTTATGTAAGTACAGTTTGTGG + Intronic
988445181 5:31278192-31278214 TCTAATGTCTTTAAAGTTCAAGG + Intronic
989780658 5:45261572-45261594 TCTATTTTATGAAGAGTTCTTGG - Exonic
992175727 5:74147020-74147042 TTTAATGTATATGCAGTGCTGGG + Intergenic
993935269 5:93992147-93992169 TTGAATGTATGTAGAGTTCCAGG - Intronic
994120753 5:96110098-96110120 TCTAATGTATGGAGAGTTTTTGG - Intergenic
994528642 5:100937163-100937185 TCTAATGTTTATATAGTTCTTGG + Intergenic
996299201 5:121961235-121961257 GCTAATTTATGTAAAGCTCTTGG + Intergenic
996414361 5:123194216-123194238 TCAAATATATTTACATTTCTTGG - Exonic
996648434 5:125844449-125844471 TCTAGGGTATTTACAGTTTTAGG - Intergenic
997398268 5:133581804-133581826 TCTAATGTATGGACAAGTTTGGG + Intronic
998097305 5:139403485-139403507 GCTAAGGCATGTAAAGTTCTTGG + Intronic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
999188127 5:149728089-149728111 GATAATATATGTACAGTGCTTGG - Intergenic
999347778 5:150839701-150839723 TCTGATGGATGTACATTTTTGGG + Intergenic
1002119841 5:176994362-176994384 TCTAATGGATATACAGTGTTAGG - Intronic
1004167350 6:13268516-13268538 ACTAACATATGTACAGTGCTTGG + Intronic
1004529825 6:16443455-16443477 TCAAATGTATATCCAGTTATTGG + Intronic
1005240147 6:23815492-23815514 TCTCATGTATATAAAATTCTAGG - Intergenic
1005717352 6:28563054-28563076 TCTAATGAATATACATTTATAGG - Intergenic
1006819756 6:36883321-36883343 TCCAATGGATGTACAGTTCCAGG - Intronic
1009334603 6:62471355-62471377 TCTAATGTATTTACAGGAATTGG - Intergenic
1009554723 6:65148586-65148608 TTTAGTGTATCTACTGTTCTGGG + Intronic
1010691873 6:78920665-78920687 TCTAGTGTTTTTACAGTTTTAGG - Intronic
1011414483 6:87103186-87103208 TCAAATGTATTTTCAGTTTTTGG - Intergenic
1014305637 6:119738048-119738070 CCTAATGTATATACAATTTTAGG - Intergenic
1014354646 6:120390607-120390629 ACTGCTGTATGTACTGTTCTTGG + Intergenic
1014400603 6:120985348-120985370 TTTAATGTATCTAGAGGTCTGGG - Intergenic
1015264177 6:131273717-131273739 ACTTACGTATGTACAGTTTTTGG + Intronic
1016377453 6:143437276-143437298 TCTAATGTTTGAACAGTTTTAGG - Intronic
1017561559 6:155633688-155633710 TCTAGTGTCTGTAAAGTGCTGGG - Intergenic
1018346202 6:162901455-162901477 TCTAAGGCATGTACTGTTCCAGG + Intronic
1018415139 6:163594504-163594526 TCTAATGTATGCACTATTATTGG - Intergenic
1018990113 6:168668233-168668255 GTTAATGTATGTAAAGTGCTTGG + Intronic
1021077297 7:16320583-16320605 TCTAATGTATATATTGTTCTTGG - Intronic
1022735869 7:33075540-33075562 TCTGATCTATGTACAGTCATAGG + Intergenic
1023076998 7:36494044-36494066 TGTAACTTATGTACAGTTCTTGG + Intergenic
1023742969 7:43297183-43297205 TCTATTGTTTGTAAAGCTCTGGG - Intronic
1026645895 7:72168445-72168467 TCTAATGAATCTACAGCTCAGGG + Intronic
1027767312 7:82361726-82361748 ACTAATGTACGTACAGTTATTGG + Intronic
1028343140 7:89747038-89747060 TTTAATGCATGTAAAGATCTTGG - Intergenic
1030644855 7:112048743-112048765 TCTACTGGATGTAGAATTCTAGG - Intronic
1031234494 7:119156601-119156623 TCTAATGTATATCCAGGTTTTGG + Intergenic
1031305353 7:120119269-120119291 TCCAATGGGTGTACAGTTCCAGG - Intergenic
1032273765 7:130436524-130436546 CACAATGTATGTATAGTTCTAGG - Intronic
1032470075 7:132171879-132171901 GATAATGTATGTAAAGTGCTTGG + Intronic
1032965987 7:137098360-137098382 TCTAAGGTTTGTATAGTTTTAGG - Intergenic
1032985932 7:137337212-137337234 TCCAATGTATGTACAGTTAGAGG - Intronic
1038508011 8:28102756-28102778 TCTAATGTATGTACAGGCTTTGG - Intronic
1038773602 8:30507370-30507392 TATAGTGTATGTAAAGTACTAGG + Intronic
1041899153 8:62961914-62961936 TCTGATGTTTGTACAGCTTTAGG + Intronic
1043495206 8:80792613-80792635 TCTCATGTATTTACAATGCTAGG - Intronic
1043637706 8:82407157-82407179 TTTAATATATGTAGAGTTTTGGG - Intergenic
1044040452 8:87361536-87361558 TCTAATGTTTATATAGTTTTAGG + Intronic
1046413305 8:113876869-113876891 TCTAGTGTTTTTACAGTTTTGGG + Intergenic
1048084849 8:131165972-131165994 TTTAAAGTATGTATAGTTCTTGG - Intergenic
1048091213 8:131242319-131242341 TCTACTATTTATACAGTTCTAGG + Intergenic
1048903724 8:139066379-139066401 TCTAATGTATTTTCAGATTTTGG - Intergenic
1049102498 8:140589598-140589620 TGTAATGAATGCAGAGTTCTAGG - Intronic
1050008728 9:1163114-1163136 TGTAATGTTTGTAAAGTTCTTGG + Intergenic
1050523502 9:6526021-6526043 TAAAATATTTGTACAGTTCTGGG - Intergenic
1051117359 9:13711696-13711718 TTCCATGTATGTAAAGTTCTAGG - Intergenic
1051833647 9:21309988-21310010 TCAAATGTGTGCACAGTGCTCGG + Intergenic
1052445822 9:28559944-28559966 TCTACTCTATGTACAGATGTTGG - Intronic
1052924472 9:34003347-34003369 TTTGATGTATGTACAGATTTGGG - Intronic
1054866260 9:70005295-70005317 TGTAATGTATGCAAAATTCTAGG - Intergenic
1055120730 9:72657707-72657729 TCTAATGTCTTTATAGGTCTTGG + Intronic
1055416855 9:76092732-76092754 AGTAATGTTTGTACAGTGCTTGG + Intronic
1056913365 9:90724167-90724189 CCTATTATATATACAGTTCTGGG + Intergenic
1057244524 9:93443699-93443721 TCTCTTGTATGTGCAGCTCTGGG + Intergenic
1058899214 9:109427378-109427400 TCAAATCTATTTACATTTCTAGG + Intronic
1059323730 9:113489038-113489060 GATAATGTATGTAAAGTGCTTGG - Intronic
1060595872 9:124848566-124848588 ATTAATGTATGTAAAGTGCTTGG - Intergenic
1186634946 X:11392827-11392849 TCAAATGTATGTACAGTCTTAGG - Intronic
1186717272 X:12265759-12265781 TCTAATTCATGTGCAGTTTTGGG - Intronic
1187652727 X:21427158-21427180 TTTAATCCCTGTACAGTTCTGGG + Intronic
1188226635 X:27606973-27606995 TCTAATATATTTATAGTTCGGGG - Intronic
1189099378 X:38173178-38173200 TCAAATGTATGTGAAATTCTTGG + Intronic
1189251049 X:39600913-39600935 TGTTATGCATGTTCAGTTCTGGG - Intergenic
1190430300 X:50372212-50372234 AATTATGTATGTACAGTGCTTGG - Intronic
1193951153 X:87800430-87800452 TCTAATGTTTTTACAGTTCCAGG + Intergenic
1194288404 X:92038920-92038942 TTTATTGGATTTACAGTTCTAGG - Intronic
1194358827 X:92921444-92921466 AGTAATGTATGTACAGTGCTTGG - Intergenic
1199867213 X:151862927-151862949 TCTAGTGGATGTACAGTAATTGG + Intergenic
1199876787 X:151937829-151937851 TTTGCTGTATGTACAGTTTTAGG + Intergenic
1201574718 Y:15450470-15450492 TTTAAAGTATGTACATTTTTTGG + Intergenic