ID: 1160484381

View in Genome Browser
Species Human (GRCh38)
Location 18:79275470-79275492
Sequence GCTAAGGACATTCCTGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160484381_1160484387 24 Left 1160484381 18:79275470-79275492 CCATTTGCAGGAATGTCCTTAGC 0: 1
1: 0
2: 1
3: 15
4: 206
Right 1160484387 18:79275517-79275539 CAAACACTCCTCTGAACATTTGG 0: 1
1: 0
2: 0
3: 22
4: 162
1160484381_1160484388 28 Left 1160484381 18:79275470-79275492 CCATTTGCAGGAATGTCCTTAGC 0: 1
1: 0
2: 1
3: 15
4: 206
Right 1160484388 18:79275521-79275543 CACTCCTCTGAACATTTGGCAGG 0: 1
1: 0
2: 1
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160484381 Original CRISPR GCTAAGGACATTCCTGCAAA TGG (reversed) Intronic
901644945 1:10711617-10711639 GCTATGAACATTCATGCACAAGG - Intronic
903296039 1:22343645-22343667 GCCAAGGACATTCCTGCCTCGGG - Intergenic
903544860 1:24117736-24117758 GCTGTGGAGATTCCTGGAAATGG + Intergenic
905671286 1:39791906-39791928 TCTGAGGGCTTTCCTGCAAAAGG + Intergenic
906941559 1:50260123-50260145 TCTAAGGATATTACTGCACAGGG - Intergenic
907395396 1:54186090-54186112 GATAAGGACATACCTGAGAATGG - Intronic
907980795 1:59478828-59478850 GCTAAGGATGTACCTGCCAAGGG + Intronic
914351632 1:146845026-146845048 GCTCAGGACATGGCTGCAGAGGG - Intergenic
915689568 1:157675472-157675494 GCTAAGAGCATTGCTTCAAAGGG + Intronic
918128179 1:181602766-181602788 ACTAAGGACATCCCAGCAAATGG - Intronic
919011763 1:191974132-191974154 GCTCAGGACATTGCTTCAAAGGG - Intergenic
919044202 1:192430698-192430720 GCTCAGGCCATTCCTGCAGAGGG + Intergenic
924036583 1:239944102-239944124 GCTCAGGCCATTCCTTCAGAGGG - Intergenic
924309322 1:242723619-242723641 GTTACGGACATGCCTGTAAAGGG - Intergenic
924863078 1:247946953-247946975 CTTAAGGACATTCCTAGAAAGGG - Intronic
1063567609 10:7184505-7184527 GATAAAGACATACCTGCAACTGG - Intronic
1064699739 10:18006793-18006815 ACTAAGAGCATTCCTGGAAAGGG + Intronic
1064825259 10:19391662-19391684 GCCAAGGAAAGTTCTGCAAAAGG - Intronic
1066056584 10:31686772-31686794 GCTCAGGCCATTTCTGTAAAGGG + Intergenic
1068154244 10:53176222-53176244 GCAAAGGACATATCTGAAAAGGG + Intergenic
1068157300 10:53217493-53217515 GCTAATCAGATTCCTGAAAAAGG - Intergenic
1068224500 10:54089671-54089693 GACAAGGACATTACTACAAAGGG - Intronic
1068428999 10:56908131-56908153 GCTATGGATATTCCTGTATAGGG + Intergenic
1069352736 10:67549139-67549161 GCTAAAAACATACCTGCAGAGGG + Intronic
1072001455 10:91199491-91199513 GCTGAGGACATGCCTGCAAGAGG + Intronic
1074177568 10:111025154-111025176 GCTAAAGACATACCTGATAAAGG + Intergenic
1074691991 10:116014461-116014483 GCTATGGACATTCCTTCAACAGG - Intergenic
1075733010 10:124647529-124647551 TCTGAGGACAGTCCTGCTAATGG - Intronic
1076830511 10:132992116-132992138 CCACTGGACATTCCTGCAAAAGG + Intergenic
1077979575 11:7286306-7286328 GCTCAGGACATTGCTTCAGAGGG - Intronic
1080706178 11:34696328-34696350 TCTATGCACATTGCTGCAAAGGG + Intergenic
1085885209 11:80513538-80513560 ACTAAGCTCATTCCTGCCAAAGG - Intergenic
1085896071 11:80641296-80641318 GCTAAGGTCATGCATGCAACAGG - Intergenic
1086619560 11:88869195-88869217 GCTAAGAAAAATCCTGGAAATGG + Intronic
1089365149 11:117917024-117917046 GAGAGGGACACTCCTGCAAATGG - Intronic
1089527385 11:119106416-119106438 GGGAAGGAAATACCTGCAAAAGG - Intronic
1090338268 11:125990197-125990219 GCTAAGGCCATTCTTGTAACTGG - Intronic
1093802204 12:23387929-23387951 CCTAAAGAAATTCCTACAAATGG + Intergenic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1097291638 12:57921379-57921401 GCAAAAGACATACCTGAAAATGG + Intergenic
1099355914 12:81635474-81635496 GCTACAGACATTCTTGCACAAGG - Intronic
1100114526 12:91288065-91288087 GCTATGGACATTCCTGCAGAGGG + Intergenic
1101336090 12:103798326-103798348 ACTAGGGACATTCCTGGAGATGG + Intronic
1104115933 12:125748972-125748994 GCTAAGGCCATTGCTTCAGAGGG + Intergenic
1104724898 12:131070062-131070084 GCTCAGGACAGACCTGCACACGG - Intronic
1107818272 13:44263734-44263756 GCTGTGGACACTCCTGCAGATGG + Intergenic
1109097873 13:58141760-58141782 GCTCAGGCCATTCCTTCAGAAGG + Intergenic
1109576280 13:64263563-64263585 GCTCAGGCCATTGCTTCAAAGGG + Intergenic
1111339262 13:86862505-86862527 GCTCAGGCCATTGCTTCAAAGGG + Intergenic
1112670997 13:101638478-101638500 GATAAGGATATACCTGCAACTGG + Intronic
1115009081 14:28522453-28522475 GCTCAGGCCATTACTTCAAAGGG + Intergenic
1116375188 14:44190512-44190534 GCTCAGGATATTGATGCAAAAGG + Intergenic
1116730922 14:48621934-48621956 GGTAAGGAAATTCTTCCAAAAGG - Intergenic
1117904346 14:60568822-60568844 GCTAAGGACCTTCAGGCAACTGG + Intergenic
1119116101 14:72023116-72023138 GCTAAGGAAATTCATGGAAATGG - Intronic
1119164250 14:72479297-72479319 GCTAAGGACATCCCTGGACTTGG + Intronic
1122138986 14:99650861-99650883 GGAAAGGGCATGCCTGCAAAGGG + Intronic
1125493372 15:40166286-40166308 GCTATGGACATTCTTGAACAAGG + Intronic
1127101098 15:55565760-55565782 GCAAAGGACATACATGGAAAAGG - Intronic
1127653082 15:61028345-61028367 GCCAAGGAAATTCATACAAACGG + Intronic
1129146804 15:73655757-73655779 GCTATGGACATTGGTGCACAAGG + Intergenic
1130671650 15:85918146-85918168 GCTAAGGACATACCTGTGATGGG - Intergenic
1131567609 15:93500968-93500990 GCTTAGGACATCCTTGCAACAGG + Intergenic
1134332142 16:13260836-13260858 GATAAGGACATACCTGAAACTGG + Intergenic
1134612555 16:15621333-15621355 ACTAAGGATATATCTGCAAATGG + Intronic
1134914306 16:18056989-18057011 GGGAAGGGCATTCCTGGAAAAGG - Intergenic
1135241548 16:20811104-20811126 GCTGAGGACATTCATGCAGGAGG - Intronic
1136354649 16:29736343-29736365 GCTAAGGGCATCCATGCAACTGG - Intergenic
1137639857 16:50019244-50019266 GCTATGCACATTCATGCATAAGG + Intergenic
1137960509 16:52877421-52877443 CCTAATGACAGTCCTCCAAAAGG - Intergenic
1139515996 16:67452728-67452750 TCTTGGGACATCCCTGCAAAGGG + Intronic
1139982402 16:70870509-70870531 GCTCAGGACATGGCTGCAGAGGG + Intronic
1142654046 17:1378249-1378271 ACTGAGGACATTTCTGCAGAAGG + Intronic
1143347797 17:6262595-6262617 GCTGAGGACATTCCTACGAGGGG + Intergenic
1145817970 17:27809076-27809098 GGGAAGGACATTCCAGCAACAGG - Intronic
1148024925 17:44580354-44580376 GCTATGGAGATTCCTCCAACAGG - Intergenic
1149007938 17:51824901-51824923 GCCAAGGCCACGCCTGCAAATGG - Intronic
1150337342 17:64340403-64340425 GTCCAGGACATTTCTGCAAAGGG - Intronic
1150735963 17:67739857-67739879 GCTGAGGAAATTCTTGGAAAAGG - Intronic
1156910213 18:42403287-42403309 TCAAAGGTCATTCCTGGAAAAGG + Intergenic
1160318452 18:77868954-77868976 GCTAAGGGCCTTCCAGCAAAGGG + Intergenic
1160406682 18:78651385-78651407 GCTCATCACATTCCTGCAGATGG + Intergenic
1160484381 18:79275470-79275492 GCTAAGGACATTCCTGCAAATGG - Intronic
1162043995 19:7987039-7987061 CGGAAGGACATTCCTGCAGAGGG + Intronic
1164674169 19:30090824-30090846 GCTAAGGACACTCCTGCTCTGGG - Intergenic
1165242237 19:34478106-34478128 ACAAAGAACATTCCTGCAACAGG + Intergenic
1166830760 19:45638478-45638500 ACCAAGGAGATTCCAGCAAAAGG + Intronic
1168381200 19:55925227-55925249 GCTAAGCACATTCCTGCCTCAGG + Intronic
925210286 2:2039518-2039540 CCTTTGAACATTCCTGCAAATGG - Intronic
926836727 2:17031613-17031635 GCTCAGGACATTGCTTCAGAGGG - Intergenic
926939402 2:18119064-18119086 GCTCAGGACTCTCCTGCACAGGG + Intronic
931452432 2:62379419-62379441 CCTAAAGACCTTCCTCCAAATGG - Intergenic
931459687 2:62439878-62439900 CCTAAAGACAATCCTCCAAAAGG + Intergenic
932648525 2:73530854-73530876 GCTCAGGACATTGCTTCAGAGGG - Intronic
933462713 2:82609345-82609367 GATAAAGACATACCTGAAAATGG - Intergenic
933984626 2:87580516-87580538 AGTGAGGACATTCCTGCAGATGG - Intergenic
936309225 2:111370284-111370306 AGTGAGGACATTCCTGCAGATGG + Intergenic
936449263 2:112621202-112621224 GCCAAGGACATTCTTGGAAGAGG + Intergenic
936517769 2:113193038-113193060 GCTAAAGTCATTGCTGCAGAGGG - Exonic
937644977 2:124256546-124256568 GCTAAGGAAGTTCCTGCAGCTGG + Intronic
938758618 2:134403388-134403410 GCTAAGGATAAGGCTGCAAATGG + Intronic
939393033 2:141593114-141593136 GATAATGATATTTCTGCAAATGG + Intronic
944134216 2:196380603-196380625 GTTAACGAAAGTCCTGCAAATGG + Intronic
944590293 2:201210553-201210575 ACTATGGCCATTCCTTCAAATGG - Intronic
945754937 2:213834214-213834236 GATAAGGACATACCTGAGAATGG - Intronic
946481702 2:220063203-220063225 TCCCTGGACATTCCTGCAAATGG - Intergenic
947900039 2:233713600-233713622 CCACATGACATTCCTGCAAAGGG + Exonic
947900748 2:233719429-233719451 CCACATGACATTCCTGCAAAGGG + Exonic
947904188 2:233747821-233747843 CCACATGACATTCCTGCAAAGGG + Intronic
1170212004 20:13855163-13855185 GGTAAGATCATTCCAGCAAAAGG + Intronic
1171335116 20:24377971-24377993 GATAAGGACATACCTGCGACTGG - Intergenic
1172116029 20:32574152-32574174 GCCAAGGACAGTCCTGCATTTGG - Intronic
1176724264 21:10416996-10417018 GCTAAGCACATTCCTGCCTTGGG - Intergenic
1177224272 21:18233394-18233416 GATAAGGAAATTGCAGCAAAAGG - Intronic
1181906709 22:26203261-26203283 GCTAAGGACATTCCAGTCAAAGG - Intronic
1183579502 22:38715473-38715495 GCCGAGGACAGTTCTGCAAAGGG - Intronic
1184379747 22:44137909-44137931 GCACAGGCCATTCCTGCACAAGG - Intronic
1184967650 22:47992756-47992778 AATGAGGAAATTCCTGCAAAGGG + Intergenic
952608740 3:35181671-35181693 GCTTAGGCCATTGCTTCAAAGGG - Intergenic
953691053 3:45119905-45119927 GCTCTGGACCTTCATGCAAATGG + Intronic
959838618 3:110949285-110949307 GCTCAGGACATTTCTTCAGAGGG - Intergenic
961060720 3:123826015-123826037 GCCAGGGACATGCCTGCAAAGGG - Intronic
962148718 3:132869980-132870002 GCTTAGGGGATTCCTACAAATGG - Intergenic
962181599 3:133211830-133211852 GCTAAGGAAAAGCCTACAAAAGG - Intronic
965831122 3:172790338-172790360 GCTCAGGCCATTCCTACCAAGGG + Intronic
967581952 3:191168969-191168991 CCTAAGTACATGTCTGCAAAAGG + Intergenic
969121937 4:4917227-4917249 GCTCAGGACATGGCTGCAGAGGG - Intergenic
971598967 4:28568555-28568577 GCTTAGGCCATTGCTGCAAAGGG - Intergenic
974556733 4:63460640-63460662 GCTCAGGCCATTGCTTCAAAGGG - Intergenic
975026059 4:69550161-69550183 GCTAAGCCCCTTCCAGCAAAGGG - Intergenic
975847292 4:78538488-78538510 GCTAATGACATGCCTGTAACTGG + Intronic
976688760 4:87845652-87845674 TTTAAGGACATTCCTGGTAAAGG + Exonic
977025930 4:91819984-91820006 GATAAGGACATTCCTGAGACTGG + Intergenic
979230683 4:118346058-118346080 CAAAAGGACATTCCTGCAGAGGG + Intronic
979409913 4:120364404-120364426 ACTAAGGACATTCTTGAAAGAGG - Intergenic
979905059 4:126278477-126278499 GCAAAGAACATTAATGCAAATGG - Intergenic
980696838 4:136367996-136368018 GGAAAGGACATTTCTACAAAGGG - Intergenic
981123659 4:141081147-141081169 GCTAAGGACATGTCTGCATTGGG + Intronic
981183937 4:141779531-141779553 GCTCAGGCCATTGCTTCAAAAGG + Intergenic
981822080 4:148898219-148898241 GCTCAGGCCATTGCTTCAAAAGG - Intergenic
982132304 4:152240797-152240819 CCTAAGGACTTTACTACAAAAGG + Intergenic
983083370 4:163414625-163414647 GCTCAGGCCATTCCTTCAGAGGG + Intergenic
983192867 4:164773140-164773162 GATAAGGACATCCAGGCAAAAGG + Intergenic
984699828 4:182811738-182811760 GCTCAGGCCATTGCTTCAAAGGG - Intergenic
985689763 5:1300661-1300683 GCTGAGGACCCTCTTGCAAAGGG - Intergenic
986625622 5:9721138-9721160 GCAAAGCACATGCCAGCAAAGGG + Intergenic
986633415 5:9796928-9796950 ACTAAGGACAGTCCTGTGAAGGG - Intergenic
988362652 5:30255629-30255651 GCTCAGGCCATTGCTTCAAATGG - Intergenic
989523655 5:42428265-42428287 GCTCAGGCCATGGCTGCAAAGGG - Intronic
991573651 5:68080595-68080617 TCTAGGGACAATTCTGCAAAGGG - Intergenic
992376274 5:76190844-76190866 GATAAGGACATTTCTGGAAATGG - Intronic
992817920 5:80463361-80463383 GCTCAGGCCATTGCTTCAAAGGG - Intronic
993419356 5:87681680-87681702 ACTGAGGAAATTCATGCAAATGG - Intergenic
993752875 5:91692140-91692162 GCTCAGGACATTGCTTCAGAGGG - Intergenic
993942153 5:94072225-94072247 GTTGGGGACATTCCTACAAATGG + Intronic
994813479 5:104554291-104554313 GCTAAGGACATACCTGATAATGG + Intergenic
996911368 5:128660586-128660608 GCTCAGGCCATTGCTTCAAAGGG + Intronic
997099990 5:130958290-130958312 GCTCAGGCCATTGCTGCAGAAGG + Intergenic
999497256 5:152111393-152111415 GCTAAGAGCATTCATGAAAATGG - Intergenic
1001694828 5:173662153-173662175 GATAAAGACATACCTGAAAATGG + Intergenic
1001756198 5:174172290-174172312 CCTAATGACATTCCTGAAGATGG + Intronic
1002830908 6:819529-819551 GCTATAGCCATTACTGCAAAAGG - Intergenic
1006247330 6:32749250-32749272 GCTAAGAACTTTTCTGCAATAGG + Intergenic
1009723486 6:67506432-67506454 GCTCAGGCCATTGCTTCAAATGG - Intergenic
1012811311 6:103962329-103962351 TCTAAGTACAGTCCTGCCAATGG + Intergenic
1013881005 6:114900656-114900678 GCTAAGGACATTTGTTCCAAAGG + Intergenic
1014258281 6:119186203-119186225 CCCAAGGACTTTCCAGCAAAGGG - Intronic
1016256975 6:142119040-142119062 GCCAAGGGCAGCCCTGCAAATGG + Intergenic
1016707605 6:147129923-147129945 GTTAAGGAAATTCCGGGAAAGGG - Intergenic
1017050010 6:150382090-150382112 GCAGAGGCCATTCCTGCAAGAGG - Intronic
1018199867 6:161384711-161384733 GTAAAGGACATTCCAGCAGAGGG - Intronic
1018884760 6:167925510-167925532 GCTAAGGACTTTGCTACACAAGG + Intronic
1020493812 7:8822364-8822386 GCTCAGGACATTGCTTCAGAAGG - Intergenic
1021477747 7:21081794-21081816 GCTATGGAGCTGCCTGCAAAAGG + Intergenic
1021838290 7:24702291-24702313 GCTAACGATATTCCTGAAAGTGG + Intronic
1022497434 7:30861884-30861906 GCTCTGGACATGCCTGCCAAGGG - Intronic
1023257225 7:38323946-38323968 GCGAAGGACACACCTGCCAAAGG + Intergenic
1023820974 7:43980386-43980408 GCACAGGACATTACTCCAAATGG + Intergenic
1024167524 7:46749699-46749721 GAGAAGGACATCCCTGCAGAAGG + Intronic
1024977836 7:55130334-55130356 GCTCAGGACATTCTTGCAATAGG - Intronic
1025150684 7:56544284-56544306 GCTAAGGACAATTCTTTAAAAGG + Intergenic
1027328324 7:77065188-77065210 GCACAGGACATTACTCCAAATGG - Intergenic
1028272961 7:88816108-88816130 GATGAGGACATTCATGCAAGAGG - Intronic
1029749246 7:102533826-102533848 GCACAGGACATTACTCCAAATGG + Intergenic
1029767189 7:102632930-102632952 GCACAGGACATTACTCCAAATGG + Intronic
1032120525 7:129152266-129152288 GCTATGAACATTCATGTAAAAGG - Intronic
1034613546 7:152394421-152394443 GCTAAGCACATTCCTGCCTCTGG + Intronic
1035707391 8:1687547-1687569 GCTAATGACATGCCTGCTAATGG - Intronic
1037049336 8:14350501-14350523 GCTTAGGCAATTCCTGGAAAGGG - Intronic
1039306000 8:36263610-36263632 TGTAAGGACATACCTGCAACTGG - Intergenic
1045821872 8:106348077-106348099 GGAAAGGACATTCCTTGAAATGG + Intronic
1045824091 8:106376270-106376292 TCTGAGGATATTCCTCCAAAGGG - Intronic
1046226348 8:111285594-111285616 GCTCAGGACATTGCTTCAGAGGG - Intergenic
1046257686 8:111722246-111722268 GCTCAGGCCATTGCTTCAAAGGG - Intergenic
1046917386 8:119692034-119692056 GCTCAGGACATTGCTTCAGAGGG + Intergenic
1049830500 8:144698746-144698768 GCCAAGGACACTCATGGAAAAGG - Intergenic
1050030783 9:1382993-1383015 GCTGAGGGCATTTCTCCAAAAGG - Intergenic
1051048072 9:12899459-12899481 GCTAAGGACTTTAATGAAAAAGG - Intergenic
1052351598 9:27464663-27464685 GATAAAGACATACCTGAAAATGG + Intronic
1052625005 9:30963107-30963129 GCTCAGGCCATTGCTTCAAAGGG - Intergenic
1053581114 9:39405234-39405256 GCTAAGGAAATGCTTGCTAAAGG + Intergenic
1054102701 9:60964038-60964060 GCTAAGGAAATGCTTGCTAAAGG + Intergenic
1054583661 9:66942828-66942850 GCTAAGGAAATGCTTGCTAAAGG - Intergenic
1055774383 9:79752120-79752142 GCTCAGGTCATTGCTTCAAAGGG - Intergenic
1056242203 9:84659048-84659070 GTAAAGGAGATTCCTGCAAATGG + Intergenic
1058213418 9:102201826-102201848 GATAAGAACATGGCTGCAAAAGG - Intergenic
1058245946 9:102625567-102625589 GCTCAGGCCATTGCTTCAAAAGG - Intergenic
1058257439 9:102785820-102785842 TCTAAGAACATTATTGCAAAGGG + Intergenic
1058717941 9:107739152-107739174 GCTAAAGTCATTTCTCCAAAAGG + Intergenic
1059413469 9:114148949-114148971 TCCAAGGACATCCCTGCAACAGG - Intergenic
1059467022 9:114475481-114475503 GAGAAGGACACTCCTGAAAAGGG + Intronic
1060461987 9:123865085-123865107 GGTGAGGACATTCCAGCAGAAGG - Intronic
1187030311 X:15480306-15480328 GATAAGGACATACCTGAAACTGG - Intronic
1188455774 X:30363885-30363907 GCTTAGGACATCCTTGCTAAAGG + Intergenic
1192121474 X:68460359-68460381 GCTGAGTACATTCCGGCGAATGG + Intergenic
1192378295 X:70587445-70587467 GCTCAGGCCATTGCTTCAAAGGG + Intronic
1195095535 X:101497974-101497996 GCTGAGGAAATTCCTGAAGAGGG - Intronic
1195852801 X:109301429-109301451 GCTAACAACATATCTGCAAAGGG + Intergenic
1196074047 X:111555442-111555464 GTTATGGACATTCATGTAAAGGG + Intergenic
1197004541 X:121480523-121480545 GCTCAGGCCATTGCTTCAAAGGG + Intergenic
1197712751 X:129683713-129683735 GCTAAGCACATTCCTGCCTCAGG - Intergenic
1198212594 X:134529784-134529806 GCTGAGGACACTACTGCCAATGG - Intergenic
1200375642 X:155776954-155776976 GTTAATGATATTGCTGCAAATGG + Exonic