ID: 1160487230

View in Genome Browser
Species Human (GRCh38)
Location 18:79304676-79304698
Sequence GGCTCTGAGGTGCCTACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160487230_1160487235 7 Left 1160487230 18:79304676-79304698 CCTGCTGTAGGCACCTCAGAGCC 0: 1
1: 0
2: 1
3: 18
4: 206
Right 1160487235 18:79304706-79304728 TGAGCACAGCCCTGGCCCTGAGG 0: 1
1: 1
2: 6
3: 66
4: 480
1160487230_1160487233 -1 Left 1160487230 18:79304676-79304698 CCTGCTGTAGGCACCTCAGAGCC 0: 1
1: 0
2: 1
3: 18
4: 206
Right 1160487233 18:79304698-79304720 CACCACACTGAGCACAGCCCTGG 0: 1
1: 0
2: 3
3: 64
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160487230 Original CRISPR GGCTCTGAGGTGCCTACAGC AGG (reversed) Intronic
900643462 1:3698227-3698249 GGCTCTGGGGTGCTGGCAGCAGG + Intronic
901841451 1:11956571-11956593 TTCTCTGAGGTGCCTGGAGCTGG + Intronic
903580165 1:24364834-24364856 GGCTCTGAGTTGGCCACAACTGG + Intronic
903664614 1:24998697-24998719 GGTTCTGAGCTGCCCACAGTGGG - Intergenic
904287240 1:29460574-29460596 GGGTGTCAGGTGGCTACAGCAGG - Intergenic
905941552 1:41867251-41867273 GGCCATCATGTGCCTACAGCAGG + Intronic
907023879 1:51095623-51095645 TGTGCTGAGGTGCCTATAGCTGG - Intergenic
907185688 1:52607459-52607481 GGCTCTGAGGCTTCTGCAGCTGG - Intronic
908319194 1:62964204-62964226 GGCTCAGTGGTGCCCACAGATGG + Intergenic
911487275 1:98517040-98517062 GGTTCTGAGCTGCCTAGAACTGG - Intergenic
915166032 1:153948251-153948273 GGCTTTGAGGTGTCAGCAGCTGG - Exonic
916360679 1:163963551-163963573 GTCTCTGAGCTGCCTGGAGCAGG - Intergenic
918187506 1:182141320-182141342 GGCTTTGGGGAGCCTAAAGCAGG + Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
922706435 1:227793131-227793153 GTCCCTGAGTTGCCTCCAGCTGG - Intergenic
923632103 1:235657430-235657452 GGCTTTGAAATGCCTGCAGCAGG + Intergenic
923678928 1:236103312-236103334 GGCTCGGCGGTGACTGCAGCTGG + Intergenic
924615752 1:245610311-245610333 GGATCTGAGGTGCTTTAAGCAGG - Intronic
1065556836 10:26924042-26924064 TGGTGTGAGGTGCCTACAGCTGG + Intergenic
1067294662 10:44968424-44968446 GGCCCTGAGGTGCCTAACTCTGG + Intronic
1073051027 10:100667611-100667633 GCTTCTGAGGTTCCTACTGCAGG + Intergenic
1073454433 10:103628107-103628129 GGCTCTCGGGTGCCTCCAGGTGG + Intronic
1073930421 10:108567857-108567879 GGCCCTGGGGTGATTACAGCAGG - Intergenic
1074285422 10:112093321-112093343 GGCTGTAGGGTGACTACAGCGGG - Intergenic
1075558813 10:123453224-123453246 GTCTCTGAGATTCCTTCAGCTGG - Intergenic
1075844447 10:125534225-125534247 TGCTCAGGGGTGCCCACAGCAGG - Intergenic
1076735575 10:132457551-132457573 GGCTCTGAGGAGGCTGCATCCGG - Intergenic
1078448111 11:11420232-11420254 GGGTCTGAGGGTCCCACAGCAGG - Intronic
1078498108 11:11841376-11841398 GCCCCTGAGGTCCCTCCAGCTGG + Intergenic
1081689258 11:45065598-45065620 TGGTCTGAGGTGGCTTCAGCGGG - Intergenic
1084119220 11:67059204-67059226 GGCTCTGAGTTCCCTGGAGCAGG + Intronic
1084433041 11:69122126-69122148 GGCTCTGAGGGGCTCACAGGCGG + Intergenic
1085546318 11:77321434-77321456 TCCTCTCAAGTGCCTACAGCCGG + Intergenic
1089243408 11:117100039-117100061 GGCTCTCAGCTGCCTCTAGCAGG + Intergenic
1089625171 11:119746472-119746494 GGCTCTGAGGAGCTCACACCAGG + Intergenic
1089647889 11:119892167-119892189 GGCTCTGATGTGCCTCCCTCTGG + Intergenic
1092263580 12:6964927-6964949 GAGTCTGGGGGGCCTACAGCAGG + Intergenic
1098564657 12:71919481-71919503 GTCTCTGAGGTTTTTACAGCTGG + Intronic
1100283331 12:93139533-93139555 CACTCTGAAGTGCTTACAGCTGG + Intergenic
1102895415 12:116594642-116594664 GGCTCTGGGGTGACTATGGCAGG + Intergenic
1104302621 12:127578936-127578958 GTCTCTGTGCTGCATACAGCAGG + Intergenic
1105225002 13:18424024-18424046 GGGTGTGAGGAGCCTCCAGCAGG + Intergenic
1105547891 13:21365084-21365106 GGCCCTGGGGTGACTAAAGCAGG + Intergenic
1107963769 13:45581007-45581029 GGTTCTATGGTTCCTACAGCAGG - Intronic
1109489225 13:63074126-63074148 GACTCTGAGATGCCTAGAACAGG + Intergenic
1109811466 13:67518875-67518897 TGCTCTGAAGTCCCTCCAGCAGG + Intergenic
1111339117 13:86861275-86861297 GGTTTTGCAGTGCCTACAGCAGG - Intergenic
1113843683 13:113374260-113374282 GGCTCTGGGGTGCCTGCGGGTGG - Intergenic
1115931858 14:38506423-38506445 GGCACTGAGGTAGCTACAGAGGG + Intergenic
1117812771 14:59566148-59566170 AGCTCAGAGTTGGCTACAGCTGG - Intronic
1117967834 14:61223756-61223778 GGCTCTGAGGGGCCTCCTGAGGG - Intronic
1118005690 14:61562642-61562664 GGCCCTGTGGTGCCTCCACCTGG + Intronic
1118503028 14:66381078-66381100 GGCTATCAGGTGCCTACTGTGGG - Intergenic
1120282997 14:82463301-82463323 GGCTCTGTGCTGCTTCCAGCTGG - Intergenic
1121298200 14:92847349-92847371 GGCTCTGAGCTGCAGACTGCAGG + Intergenic
1121620834 14:95347162-95347184 GGCCCTTAGGTCCCTACATCAGG + Intergenic
1122847767 14:104510188-104510210 GGCCTTGTGGTGCCTTCAGCTGG + Intronic
1123031511 14:105453999-105454021 GCCTGGGAGGAGCCTACAGCGGG - Intronic
1124200494 15:27674841-27674863 GGCTCTGCTGTGCCCACAGAGGG - Intergenic
1124421817 15:29529466-29529488 GGCTCTGAGGTGTTTAGGGCTGG + Intronic
1126418530 15:48445390-48445412 GGCTATGAGGTGGCTCCAGATGG - Exonic
1126592213 15:50351889-50351911 AGCTCTGATGTGCCTACATTGGG - Intronic
1126780842 15:52137754-52137776 GGCTCTGTGATGCCGCCAGCTGG - Intronic
1127296676 15:57614691-57614713 GGCTCTTGGGTTCCTACGGCTGG + Intronic
1127410325 15:58698927-58698949 GTCTCTGAGGTTCCTATATCTGG - Intronic
1128389606 15:67174170-67174192 CGCTCTGAGGAGCCTGCAGAAGG + Intronic
1128444280 15:67743081-67743103 GGCTTTAAGATGCCTACAGGAGG - Intronic
1128921486 15:71614344-71614366 GGCTCTGAGGTGGAAAAAGCAGG - Intronic
1132316186 15:100892076-100892098 GGCTCTGGGGTGGCTGCAGTGGG - Intronic
1132695057 16:1198371-1198393 GGGTCTGACGTGCATCCAGCGGG - Intronic
1133009731 16:2904494-2904516 GGCTCTAAGGTGGCTTCTGCAGG + Intergenic
1133786170 16:8975169-8975191 GGCCCTGAGGTGCCTTCCCCAGG - Intergenic
1134055913 16:11169800-11169822 GGCCCTGCCGTGGCTACAGCAGG - Intronic
1134337553 16:13315087-13315109 GCATCTGAGATGCCAACAGCAGG - Intergenic
1136847601 16:33589063-33589085 GGGGCTGAGGTGCCCACAGAGGG - Intergenic
1138291914 16:55855096-55855118 GGCTCTGTGGTGCCCACAGGAGG - Intronic
1141157225 16:81605641-81605663 GGCTCAGAGGTGGGAACAGCTGG - Intronic
1142306631 16:89289623-89289645 GGCTCAGAGGTGCCCTCTGCTGG + Intronic
1203109309 16_KI270728v1_random:1437718-1437740 GGGGCTGAGGTGCCCACAGAGGG - Intergenic
1142685571 17:1575325-1575347 GTCTCTGTGGTGCCTGCAGCAGG - Exonic
1144704030 17:17355677-17355699 GGCTCTGACTTCCCTGCAGCAGG + Intergenic
1147442342 17:40454791-40454813 GGCTCTGGTGTGCCTCCTGCTGG + Intronic
1147757543 17:42778991-42779013 GGCTCTGCAGGCCCTACAGCAGG + Exonic
1148752801 17:49955284-49955306 GGCTGGGAGGGGCCTCCAGCAGG - Intergenic
1149013274 17:51880094-51880116 GGCTCTGGGGTGATTAGAGCAGG - Intronic
1149981775 17:61316590-61316612 GACTCAGAGGGGCCTGCAGCTGG + Intronic
1150565834 17:66338683-66338705 GGCTTTGAGGAGCCTACAGTGGG + Intronic
1150692698 17:67378665-67378687 GGCTCAGAGGTTCCTCCCGCGGG - Intronic
1151203621 17:72488313-72488335 GGCTCCGAGGTGGTGACAGCAGG - Intergenic
1151664981 17:75540566-75540588 GGCTCTGAGCTGCCAGCATCTGG + Intronic
1152354918 17:79802152-79802174 GGCTCTGAGGGTCCTCCTGCTGG - Intergenic
1152558028 17:81064267-81064289 GGCCCTGTAGTGCCCACAGCCGG + Intronic
1152754231 17:82080438-82080460 GGCTCTGCTGGGCCTGCAGCTGG + Exonic
1160487230 18:79304676-79304698 GGCTCTGAGGTGCCTACAGCAGG - Intronic
1160771788 19:835297-835319 CGCTCTGAGGGCCCTGCAGCCGG - Intergenic
1162645275 19:12045032-12045054 GGCTCTGAGGTGCCTATTAAGGG + Exonic
1162843588 19:13373962-13373984 GGCTTTGAGGGGCACACAGCAGG + Intronic
1163187019 19:15645927-15645949 GTCTCTGTGCTGCCTCCAGCGGG + Intronic
1163408056 19:17135979-17136001 GGCCCTGGGGTGTCTGCAGCAGG - Intronic
1163861223 19:19743935-19743957 GGCTCTGCGTTCCCTCCAGCTGG - Intergenic
1167909465 19:52690095-52690117 GGCTGGGAGGTGCCCACGGCGGG + Intronic
927192356 2:20525301-20525323 GGATCTGAGGTGCCTGCTCCTGG + Intergenic
928537087 2:32251374-32251396 GGCTCTGAAGAGCCTGCAGGAGG + Exonic
928617343 2:33053755-33053777 GGCCCTGCTTTGCCTACAGCAGG - Intronic
929394783 2:41510305-41510327 TCCTCAGAGGTGCCTGCAGCAGG + Intergenic
929498072 2:42464041-42464063 GGCTCGGTGGTGGCTGCAGCGGG + Intronic
932573565 2:72950855-72950877 GGCTCTGAGGGGCCTTCTCCGGG + Intronic
932714598 2:74092162-74092184 GGATTAGAGGTGCCCACAGCCGG - Intronic
936885153 2:117300804-117300826 TGCTCTGAGCTGCCTGGAGCTGG - Intergenic
937203363 2:120220091-120220113 GGCACTCAGGTTCCTAGAGCTGG + Intergenic
937449867 2:121993070-121993092 GGCTCTGTGGCCCCTACAGCTGG - Intergenic
938418014 2:131120580-131120602 AGCCCTGAGGTGCCTACATTTGG - Intronic
938555057 2:132416640-132416662 GGCTCTCAAGTGCCGGCAGCTGG + Exonic
938566112 2:132520586-132520608 GCCTCTGAGGACCCTACTGCAGG - Intronic
939826249 2:147018885-147018907 GGCTCAGAGGTGACCACAGCAGG - Intergenic
940982967 2:160023911-160023933 GGCTCTGAGCTGCTTATAACGGG - Intronic
944043173 2:195378875-195378897 GGCTCTGAGGGTCCTACCCCAGG - Intergenic
947716117 2:232339653-232339675 GGATCTGCTGTGCCTGCAGCTGG + Intronic
948807216 2:240458233-240458255 GGCCCTGAGGTGTGCACAGCAGG + Intronic
1169357215 20:4917388-4917410 AGCTCTGTGGTGAGTACAGCGGG + Intronic
1170507927 20:17047773-17047795 GGGACAGAGGTGCCTACAGCAGG - Intergenic
1172841335 20:37904179-37904201 GGCTCTGAGGGGCTTCCACCAGG - Intronic
1172903188 20:38349685-38349707 GGCTCTGAAGTGGCTGGAGCTGG + Intronic
1175871755 20:62212593-62212615 GGCCCTGAGGCTCCTCCAGCAGG - Intergenic
1176309523 21:5142279-5142301 GGGTCTGTGGTGCCGGCAGCCGG - Intronic
1176769053 21:13053042-13053064 GGGTGTGAGGAGCCTCCAGCAGG + Intergenic
1179126497 21:38595575-38595597 TGCTCTGAGGTGGCCCCAGCAGG - Intronic
1179847537 21:44119754-44119776 GGGTCTGTGGTGCCGGCAGCCGG + Intronic
1180119480 21:45737208-45737230 GGCTGAGAGGAGCCCACAGCAGG + Intronic
1181086479 22:20441889-20441911 GGCCCTGAGATGCCTGCGGCAGG + Exonic
1181506498 22:23361815-23361837 GGCCCTGTGGTGCCCACAGAAGG - Intergenic
1182360419 22:29743307-29743329 GGCCCTGAGTGCCCTACAGCTGG - Intronic
1182635943 22:31727136-31727158 GGCTCTAAGGTGCCGCTAGCTGG + Intronic
1183154651 22:36065849-36065871 GGCTCGGAGGAGCTCACAGCGGG + Intergenic
1183742412 22:39676107-39676129 GGCTCTGAGATGCTGACAGCAGG + Intronic
1185410061 22:50677204-50677226 GCCTTTGAGGTGTCTACTGCTGG + Intergenic
950476833 3:13220098-13220120 AGCACTGAAGTGCCTAAAGCTGG - Intergenic
950675983 3:14554686-14554708 GACTCTGAGGTGCCTACACAGGG - Intergenic
954002987 3:47572415-47572437 GGCTCTCAGATGCCTAGTGCAGG + Intronic
954955994 3:54518531-54518553 GGCCAAGAGGAGCCTACAGCTGG - Intronic
954973989 3:54675800-54675822 GGCTCTGAGAGACCTACAACAGG + Intronic
955508781 3:59658586-59658608 TGCTTTGAGGTGTCTATAGCTGG + Intergenic
958815998 3:98916251-98916273 GGCTCTGAGGGGCCTGGGGCTGG - Intergenic
962809782 3:138950197-138950219 GCCTCGGAGGTCCCGACAGCCGG + Intronic
963998607 3:151740130-151740152 TGCTCTCATGTGCCTACAGCAGG - Intronic
964558501 3:157967133-157967155 GGCTCTGAGGTCTCCCCAGCGGG + Intergenic
965523435 3:169691713-169691735 GGCTCTGAGTTGCCCACCTCTGG - Intergenic
966721298 3:183064776-183064798 GGCTCTGAGGCGCCTCCTGCCGG - Intronic
968564465 4:1303643-1303665 GGGTCTGAGGGGACTACAGCGGG + Intronic
969161717 4:5265480-5265502 AGCTCTGAGGTGCTTCCAACTGG - Intronic
969842380 4:9892016-9892038 GGCACTGGGGTCCCTGCAGCTGG - Intronic
970084071 4:12325547-12325569 GGATATGAGGTGCCTGCAGAGGG + Intergenic
970448941 4:16148232-16148254 GGGTCAGAGGTTCCTACAGTGGG + Intergenic
970692017 4:18630861-18630883 GGCTCTGAGGGCCCTACACTCGG - Intergenic
970997404 4:22283055-22283077 GGCTCTAAGCTGCATACAGCAGG - Intergenic
971159753 4:24121564-24121586 GGATCTGAGGTGCCTAGAACCGG - Intergenic
971797963 4:31253317-31253339 GGCTCTGAGGGGCCCAGAGAAGG + Intergenic
972395455 4:38655392-38655414 GGCTCTGAGGTGCTTTCAAAGGG + Intergenic
974819722 4:67051176-67051198 GCCTCTGAAGTACTTACAGCTGG - Intergenic
975224067 4:71849146-71849168 GGCTCTGCAGGGCCTACTGCAGG + Intergenic
975579815 4:75896225-75896247 GGCTTTGTGGTACCCACAGCTGG + Intronic
976205501 4:82619756-82619778 GACTCTGGGGTGCAGACAGCTGG - Intergenic
977834679 4:101634049-101634071 GGCTCAGCTATGCCTACAGCAGG - Intronic
985929425 5:3045239-3045261 GGCTCAGAGGGGCCAACAACCGG + Intergenic
988117957 5:26920617-26920639 TGCGCTGAGCTGCCTGCAGCTGG - Intronic
990048874 5:51469993-51470015 GGCTCTGATCTGCCAACAGTGGG - Intergenic
993155712 5:84219134-84219156 TGCTCTGAGCTGCCTGGAGCTGG - Intronic
997454043 5:134004666-134004688 GGCTCGGAGGCGGCTACGGCGGG + Intronic
998405045 5:141869482-141869504 GGCCCTGAGCTGCCCAGAGCTGG + Intronic
1001118773 5:168961665-168961687 GGCTCTGTGGTGCAGAAAGCAGG + Intronic
1001222628 5:169915046-169915068 GGCTCTGGGGTGAAGACAGCTGG - Intronic
1001658471 5:173372565-173372587 GGCTTTGTGGTGACCACAGCTGG + Intergenic
1001691193 5:173633774-173633796 GGCTCTGACCTGCCTGAAGCAGG - Intergenic
1004277600 6:14252442-14252464 GGCGATGAGGTGACTTCAGCAGG + Intergenic
1004351264 6:14892261-14892283 GGCTCTCAGGTAACTGCAGCGGG - Intergenic
1006019494 6:31109652-31109674 GGCTCTGGGAGGGCTACAGCCGG + Intergenic
1006436549 6:34028761-34028783 GGCTCTCAGGAGACCACAGCTGG + Intronic
1007151870 6:39701398-39701420 TGCTCTGAGGTGTATACAGCGGG + Intronic
1011762939 6:90587447-90587469 TCCTCTGAGCTGCCTGCAGCCGG + Intergenic
1013290276 6:108713369-108713391 GGCTCTCAGCTGTCTGCAGCAGG - Intergenic
1017013306 6:150079747-150079769 GGCTCTGAGGTGCTGAGAGCAGG - Intergenic
1017120444 6:151019029-151019051 GCCTCTGACTTGCCCACAGCAGG - Intronic
1018421896 6:163647379-163647401 CGGTCTGAGGTTCCTGCAGCGGG - Intergenic
1019261984 7:86890-86912 GGCTCTGAGGGTCCTGCAGGAGG - Intergenic
1023584985 7:41719827-41719849 GGCTCTGATCTGCCTAGACCAGG - Intergenic
1023855776 7:44182860-44182882 GCCAGTGAGGTGCCAACAGCAGG - Intronic
1027173034 7:75886223-75886245 GGCTCTGAGCTGTTGACAGCTGG - Intronic
1028783657 7:94767411-94767433 GGTTCTTAGGTGTCTTCAGCAGG - Intergenic
1029078333 7:97953205-97953227 AGCTCAGATCTGCCTACAGCAGG - Intergenic
1029170707 7:98627486-98627508 AGGTCTGAGGGGCCAACAGCTGG - Intronic
1033223304 7:139542948-139542970 GGCTCTGAGGTGCCAGCCGGAGG + Intronic
1039365196 8:36921735-36921757 GCCTCTGAGGTGAATACCGCTGG - Intronic
1039786625 8:40840017-40840039 GGCTGTGAGATGCCTACTGATGG + Intronic
1040734621 8:50490727-50490749 TGACCTGAGGTGCCTGCAGCGGG + Intronic
1040964823 8:53072860-53072882 GGCTCAGCTTTGCCTACAGCAGG - Intergenic
1041381993 8:57260589-57260611 GGCCCTGCGGTCCCTGCAGCTGG - Intergenic
1042179998 8:66078112-66078134 GGCCCTGAGGTGCCATCAGGTGG - Intronic
1043540382 8:81255687-81255709 GGCTCTAATGTCCCCACAGCAGG - Intergenic
1045444976 8:102251734-102251756 GGCTCTCAGGAGCTTTCAGCGGG + Intergenic
1046448508 8:114357340-114357362 TGTTCTGAGCTGCCTAAAGCTGG - Intergenic
1047499823 8:125432061-125432083 TGCTCTGGGGTGCCTCAAGCAGG - Intronic
1047787259 8:128165761-128165783 GGCTACCAGGTGCCTACAGATGG + Intergenic
1048885912 8:138909718-138909740 GCCTCTGAGTTGCTTCCAGCAGG + Intronic
1049105197 8:140608499-140608521 GGCCCTGAGCTGCCCGCAGCCGG + Intronic
1049327136 8:142028277-142028299 GTATCTGAGGTGCCTAAAGGTGG + Intergenic
1049428143 8:142546568-142546590 GGCTCTGTGCTGCCTTCTGCAGG - Intergenic
1049604071 8:143521031-143521053 GGCTCTCAGCTGCAAACAGCTGG + Intronic
1049655544 8:143795399-143795421 AGGTCAGAGGTGCCTGCAGCCGG - Exonic
1056115728 9:83439402-83439424 TGCTCTGAGGAGCCTACTGATGG + Intronic
1057101919 9:92369382-92369404 GGCCCTGGGGTGATTACAGCAGG + Intronic
1060243489 9:121925298-121925320 GGCTCTGAGGGGCCCACAAGAGG - Intronic
1060933874 9:127505001-127505023 GGCCCTGGGGTGCCCACAGAGGG - Intergenic
1061753860 9:132799175-132799197 GGCTCTGCGGTGCGGACAGCAGG - Intronic
1062303827 9:135890647-135890669 GGCTCTGAGGCACCTCCACCAGG + Intronic
1062604410 9:137338988-137339010 GGCTCTGCTGTGTCTGCAGCTGG - Intronic
1203624815 Un_KI270750v1:5297-5319 GATTCTGAGATGCCTAAAGCAGG + Intergenic
1186028900 X:5345702-5345724 GGCTCTGAGTTGGGTGCAGCAGG + Intergenic
1187951446 X:24474841-24474863 GGCTCTGAGGTTCACAGAGCCGG - Intronic
1189426887 X:40909819-40909841 GGCTCTCAGCTGCCTACCCCAGG - Intergenic
1190359182 X:49633378-49633400 GGCTCAGAGGTGGCTACAGCGGG + Intergenic
1190545389 X:51520510-51520532 GTCTCTGAGGTGCCTACCAGAGG - Intergenic
1191257112 X:58284345-58284367 CGCTTTGGGGTGCCTACAGTGGG + Intergenic
1193204749 X:78735725-78735747 TGTTCTGAGGTACCTAAAGCTGG + Intergenic
1194705217 X:97167538-97167560 GTCTCTGAGGTCCCTTCAGCAGG - Intronic
1196734565 X:118973267-118973289 GGCTAAGAGGTGGCTGCAGCAGG + Intergenic
1198378317 X:136061153-136061175 GGCTCTGAGGTGCAGACTCCCGG + Intergenic