ID: 1160488144

View in Genome Browser
Species Human (GRCh38)
Location 18:79312124-79312146
Sequence AGGTGCCTTCGCGGAGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160488138_1160488144 0 Left 1160488138 18:79312101-79312123 CCTTCGCCGAGGTGCCTTCACAA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1160488144 18:79312124-79312146 AGGTGCCTTCGCGGAGGTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 106
1160488140_1160488144 -6 Left 1160488140 18:79312107-79312129 CCGAGGTGCCTTCACAAAGGTGC 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1160488144 18:79312124-79312146 AGGTGCCTTCGCGGAGGTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 106
1160488136_1160488144 16 Left 1160488136 18:79312085-79312107 CCGGTCTGCTCACGCGCCTTCGC 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1160488144 18:79312124-79312146 AGGTGCCTTCGCGGAGGTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160488144 Original CRISPR AGGTGCCTTCGCGGAGGTGC TGG Intronic
900123591 1:1059696-1059718 CAGCGCCTTCGCGGAGTTGCCGG + Intergenic
901853575 1:12030499-12030521 AGGCGCCTTGGTGGAGGAGCTGG + Intronic
902122775 1:14181858-14181880 AGTTCCCTTGGCTGAGGTGCTGG - Intergenic
916053737 1:161053327-161053349 AGCGGCCTTCATGGAGGTGCGGG - Exonic
917174609 1:172219608-172219630 GGGAGCCTTCACAGAGGTGCTGG + Intronic
923549907 1:234955313-234955335 AGCTGCCTTCCAGGAAGTGCTGG + Intergenic
1062816979 10:508081-508103 AGGTGGCTGAGCAGAGGTGCTGG - Intronic
1062917091 10:1248841-1248863 TGGTGCTTTGGCGGGGGTGCAGG - Intronic
1071163275 10:82777486-82777508 AGGTTCATTCTCTGAGGTGCAGG + Intronic
1077002301 11:330363-330385 GGGTGCCTTCCAGGAGCTGCTGG + Intergenic
1077135492 11:996155-996177 AGGGGCCTTCCCGTGGGTGCTGG + Intronic
1077250867 11:1560117-1560139 AGGTGTCCTCGGGGTGGTGCTGG - Intronic
1079030337 11:16981892-16981914 TGGTGCCTTCGGGGAGGGCCAGG - Intronic
1082974995 11:59062689-59062711 AGCTAACTTCGCGGAGGGGCTGG - Intergenic
1086402480 11:86472166-86472188 TGGTGCCTTCCTGGAGCTGCAGG + Intronic
1090289406 11:125528715-125528737 AGGTGGCTTCGGGGATGTTCTGG + Intergenic
1091145159 11:133273196-133273218 AGGTGCCTAAGAGAAGGTGCTGG - Intronic
1092046122 12:5432803-5432825 AGGAGCTTTCTCGGAGGAGCAGG - Intronic
1099956174 12:89353919-89353941 AGGTAACTTTGGGGAGGTGCGGG + Intergenic
1101725199 12:107383017-107383039 AGGTGCCATTGAGGAGGTGAGGG - Intronic
1101957961 12:109227421-109227443 AGGTGCCGTCCGGGAGCTGCCGG - Exonic
1102281833 12:111624620-111624642 TGGTGTCTTCTCGGGGGTGCAGG + Intergenic
1107716952 13:43209602-43209624 AGGTGCATTCATGGAGATGCAGG + Intergenic
1113887384 13:113667980-113668002 AGGGGGCTTCGGGGAGGTGTCGG + Exonic
1121413695 14:93764330-93764352 AGGTGTCCTGGAGGAGGTGCTGG - Intronic
1122801048 14:104229638-104229660 AAGTGACTTCGCGGACGGGCAGG - Intergenic
1123039242 14:105483662-105483684 AGGTGCCCTCCCGGGGCTGCAGG - Intergenic
1124098186 15:26669003-26669025 AGCTGCCATCACGGAGGGGCAGG - Intronic
1124616730 15:31247635-31247657 AGGTGCCTTCGCTGAACTGCAGG - Intergenic
1128147077 15:65337700-65337722 AGTTGCCTTCCTGGAGGTGGAGG - Intronic
1129452110 15:75656960-75656982 AGGCGCCTTCGCCAAGGTGAAGG + Exonic
1130682581 15:86009605-86009627 AGAAGCCTTCCCGCAGGTGCAGG - Intergenic
1131053952 15:89364798-89364820 AGGTGCCTCCACGGAGGGCCTGG - Intergenic
1132534004 16:468004-468026 AGGGGCGTTGGAGGAGGTGCAGG + Intronic
1132534016 16:468046-468068 AGGGGCGTTGGAGGAGGTGCAGG + Intronic
1132930987 16:2459185-2459207 AGGTGCCATCGCAGAGGGGAAGG - Intergenic
1133285255 16:4687748-4687770 AGGTGCCTGGCCGGGGGTGCAGG + Intronic
1135135426 16:19883520-19883542 AGGTTCCTTGGCTGAAGTGCCGG + Intronic
1139603074 16:67998438-67998460 AGCTGCCTTCCCGGGGGGGCAGG + Intronic
1142891546 17:2947249-2947271 AGGTGGCTTGGCGGGGGTGGTGG + Intronic
1145279432 17:21457105-21457127 AGGCGCCTGCGGGGAGGGGCGGG - Intergenic
1145398442 17:22513382-22513404 AGGAGCCTGCGGGGAGGCGCGGG + Intergenic
1151226017 17:72648894-72648916 TGGTGCCTTTGCCGTGGTGCTGG - Exonic
1151576615 17:74955691-74955713 AGGTGGCCTCTGGGAGGTGCTGG - Intronic
1152255839 17:79239012-79239034 AAGAGCCTCCGGGGAGGTGCAGG - Intronic
1152656690 17:81523202-81523224 AGCTGCTTTCGGGGAGGGGCAGG + Intronic
1154198837 18:12285338-12285360 AGGTGCCTCCTCGGGCGTGCTGG + Intergenic
1160488144 18:79312124-79312146 AGGTGCCTTCGCGGAGGTGCTGG + Intronic
1160779020 19:869631-869653 GGGCGCCTTCCCGGAGGTCCCGG + Intronic
1160890081 19:1373139-1373161 AGGGGCCTTCGCTGAGCTACCGG + Exonic
1161015263 19:1980032-1980054 CGGTGCCTTCGGGGAGGTGGGGG + Intronic
1161062977 19:2224270-2224292 TGGTGCCTGGGCGGAGGTGCTGG + Intronic
1162898214 19:13778170-13778192 AGGTGTCTTGGAGGAGGTGGCGG - Exonic
1164573498 19:29391149-29391171 AGGTGACATCATGGAGGTGCAGG + Intergenic
1165717071 19:38053124-38053146 TGGTGGCTTCACGGAGGTGAGGG + Intronic
1167452516 19:49580494-49580516 AGGTGAGTTCGAGGCGGTGCAGG - Exonic
1168244303 19:55103455-55103477 AGGCGCCTGTGCGGGGGTGCCGG + Exonic
927981080 2:27375646-27375668 AGGAGCCTTCTCGGAGTTGCTGG - Exonic
931292073 2:60881808-60881830 AGCTGCCTGCGGGAAGGTGCGGG + Exonic
934814089 2:97309755-97309777 TGGTGCCTTCACGGGGGTGGGGG + Intergenic
935152380 2:100449573-100449595 AGGAGCATTCGAGGAGGAGCGGG - Intergenic
935354844 2:102188131-102188153 AGGTGACTTCGGGGAGGGGAAGG + Intronic
936019515 2:108984217-108984239 AGTTGGCTTGGCTGAGGTGCAGG - Intronic
936073109 2:109384399-109384421 AGCGGCCTTCGGGGAGGGGCAGG + Intronic
938706235 2:133929999-133930021 GGGAGCCTTCGTGGAGGTGAAGG - Intergenic
939542222 2:143508205-143508227 AGGTTCCTTAGAGGAGGAGCAGG - Intronic
940300905 2:152175755-152175777 AGGTGCGGTGGCGGAAGTGCAGG - Exonic
940657271 2:156503093-156503115 TGGTGCCTTGGCTGTGGTGCTGG + Intronic
943533778 2:189121490-189121512 AGGTGCCTTGGAGGAGGGGTGGG + Intronic
948860402 2:240750128-240750150 AGGTGCCTTGGGGGCTGTGCAGG - Intronic
1173827831 20:46058598-46058620 CGGTGCCTTCGCTGGGGAGCAGG + Intronic
1175814426 20:61876172-61876194 AGGGGCCATCCCAGAGGTGCCGG - Intronic
1175904497 20:62372736-62372758 AGGGGCCTTTGCAGAGCTGCAGG - Intergenic
1176010171 20:62889182-62889204 CGGTGCCATCCGGGAGGTGCTGG + Intronic
1176021515 20:62964545-62964567 AGGTGCCTTCCTGGAGGGTCAGG - Intronic
1176244130 20:64089358-64089380 AGCTGCCTTGGTGGGGGTGCAGG + Intronic
1180014209 21:45072404-45072426 ACAGGCCTTCGCTGAGGTGCGGG - Intergenic
1180091222 21:45534687-45534709 AGGGGCCGTTGAGGAGGTGCAGG - Intronic
1180898502 22:19354258-19354280 AGGCGCCTGTGCGGAAGTGCAGG - Intronic
1181838238 22:25628953-25628975 AGGTGCCTTGGGGGTGGTGATGG + Intronic
1184681939 22:46077070-46077092 TGGTCCCTTCTCTGAGGTGCTGG + Intronic
1184682755 22:46080644-46080666 AGGTGACTTACCCGAGGTGCCGG - Intronic
950528213 3:13536934-13536956 AGGTGCCCTGGGGGAGGGGCAGG + Intergenic
954909057 3:54087900-54087922 TGGTGCCCTCGGGGAGGGGCGGG - Intergenic
964426066 3:156555081-156555103 AGGAGCCATGGCGGAGCTGCAGG + Exonic
973551293 4:52038301-52038323 GGGTGCGGTCGCGGAGGGGCGGG - Exonic
974479942 4:62430206-62430228 GGGTGCCCTGGCGGAGGAGCAGG + Intergenic
976531471 4:86158268-86158290 GGGTTCCTTTCCGGAGGTGCTGG - Intronic
983247555 4:165305699-165305721 AGTTGCCTTCCAGGAGGTGCAGG + Exonic
983593526 4:169441183-169441205 AGCTGCCTTCCTGGAGTTGCTGG + Intronic
984948693 4:184990224-184990246 AGCTGCCTTCCCGGGGGGGCAGG - Intergenic
992226985 5:74628419-74628441 AGGTGCTTCCCCTGAGGTGCAGG - Exonic
997202576 5:132020729-132020751 AGGTGCCTGGAGGGAGGTGCAGG - Intergenic
1005476927 6:26217070-26217092 AGTTGCCTTTGCGGAGGAGGCGG - Exonic
1007632966 6:43283065-43283087 AGTTGCCTTGGGGGAGGTGCTGG + Exonic
1012415216 6:99005666-99005688 ATGTGCCTTGTCGGAGGTGGCGG - Intergenic
1018049452 6:159996558-159996580 AGGTGTCTGCGGGGAGGTGTGGG + Intronic
1019468562 7:1204548-1204570 AGGTGCCTGGGCGGAGTGGCTGG - Intergenic
1019775246 7:2908717-2908739 AGGTGCGTGCGAGGAGGGGCGGG + Intronic
1029728618 7:102425041-102425063 AGATGCCTCCGCAGAGCTGCTGG - Exonic
1035557984 8:580484-580506 AAGGGCCTTTGCGGAGGTTCTGG - Intergenic
1038577482 8:28717430-28717452 CGGTGCCGTCCCGGTGGTGCTGG + Exonic
1047387813 8:124426024-124426046 AGGTGCCTTCCCGCTGCTGCGGG + Intergenic
1049557273 8:143289373-143289395 AGGTGCCTTGGCGAAGATCCTGG - Intergenic
1057631168 9:96720033-96720055 TGGTGCCGTCCCGGGGGTGCGGG + Intergenic
1059409563 9:114123635-114123657 AGGTGCTTATGCAGAGGTGCAGG - Intergenic
1062150684 9:135017295-135017317 AGGTGGCTTCTGGGAGGGGCAGG + Intergenic
1186669996 X:11758364-11758386 AGGTGCCGCCGCGGAGGGACAGG + Exonic
1189358542 X:40329982-40330004 AGGTGCCATCTCTAAGGTGCAGG + Intergenic
1197771356 X:130091635-130091657 AGGTGCCTGCAGGGAGGTGTGGG + Intronic
1200292705 X:154887151-154887173 GGGCGCCTTCTCGGACGTGCTGG + Exonic
1200339549 X:155382891-155382913 GGGCGCCTTCTCGGACGTGCTGG + Exonic
1200346921 X:155457802-155457824 GGGCGCCTTCTCGGACGTGCTGG - Exonic