ID: 1160490266

View in Genome Browser
Species Human (GRCh38)
Location 18:79331924-79331946
Sequence CTTGAACAACACGAGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160490257_1160490266 18 Left 1160490257 18:79331883-79331905 CCCTGGACATTGTATTGTAAAGG 0: 1
1: 0
2: 2
3: 11
4: 144
Right 1160490266 18:79331924-79331946 CTTGAACAACACGAGGGCCAGGG 0: 1
1: 0
2: 4
3: 34
4: 196
1160490259_1160490266 17 Left 1160490259 18:79331884-79331906 CCTGGACATTGTATTGTAAAGGA 0: 1
1: 0
2: 1
3: 13
4: 178
Right 1160490266 18:79331924-79331946 CTTGAACAACACGAGGGCCAGGG 0: 1
1: 0
2: 4
3: 34
4: 196
1160490256_1160490266 29 Left 1160490256 18:79331872-79331894 CCTGAGTTGGGCCCTGGACATTG 0: 1
1: 0
2: 0
3: 13
4: 153
Right 1160490266 18:79331924-79331946 CTTGAACAACACGAGGGCCAGGG 0: 1
1: 0
2: 4
3: 34
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160490266 Original CRISPR CTTGAACAACACGAGGGCCA GGG Intronic
900811547 1:4805574-4805596 CTTGAACAACATGAGAGTTAGGG - Intergenic
904392710 1:30196398-30196420 CCAGCACAACACCAGGGCCAAGG + Intergenic
904669414 1:32152037-32152059 TTTGAACAACATGATGGGCATGG + Intronic
905418985 1:37826013-37826035 CTTGAACAACACAGGGGCTAGGG - Intronic
906765491 1:48427661-48427683 CTTAAACAACATGGGGGCTAGGG + Intronic
907020513 1:51062036-51062058 CTTGAACAACATGAGGGGTTGGG + Intergenic
908264490 1:62364957-62364979 CTTGAACAACATGGGAGTCAGGG + Intergenic
908671720 1:66555459-66555481 CTTGATGAACAAGAGGGACAGGG - Intronic
909145227 1:71921906-71921928 CTTGAACAACATGAGGGTTAGGG - Intronic
909383127 1:75024200-75024222 CTTGAACAACATGAGGGTTTGGG + Intergenic
909979781 1:82084986-82085008 CTTGAACAACATGGGGGTTAGGG + Intergenic
911215232 1:95185861-95185883 CTTGAGCAACACCAGGGTTAGGG - Intronic
911266336 1:95749009-95749031 CTTGAACAACTAGAGGGTTAGGG - Intergenic
911728906 1:101271300-101271322 CTTGAAAAAGATGAGGCCCAAGG + Intergenic
912104615 1:106256815-106256837 CTTGAACAATATGGGGGTCAGGG + Intergenic
913397706 1:118390440-118390462 CTTGAACAACATGGGGGTTAGGG - Intergenic
916951852 1:169788601-169788623 CTTGAACAACATGGGGGCAGGGG - Intronic
918397426 1:184128973-184128995 CTTGAACAACACAAGGGATTAGG + Intergenic
922661178 1:227431768-227431790 CTGGAAGCACACGAGGGCCCTGG - Intergenic
923006337 1:230052948-230052970 CTTGAACAACATGGGGGTTAGGG + Intergenic
923053513 1:230405610-230405632 CTTGAACAACACAAGGCTTAGGG - Intronic
923872457 1:238010921-238010943 CTTGAACAACACAGGGGTTAAGG - Intergenic
923903535 1:238356229-238356251 CTTGAACAACATGGGGGTTAAGG - Intergenic
923934120 1:238742509-238742531 CTTGAACAACATGAGGATAAGGG + Intergenic
924602148 1:245500675-245500697 CTTGAACTTCACCAGGGCGAGGG + Intronic
1066120719 10:32283827-32283849 CCTGAACAACATGAGGGTTAGGG - Intronic
1066221829 10:33342742-33342764 CTTGAACAATATGGGGGCTAGGG + Intergenic
1067542930 10:47169350-47169372 CTTGAACAACATGGGGGTTAGGG - Intergenic
1068571517 10:58634654-58634676 CTTGAACAACACAGTGGCGAGGG + Intronic
1069357756 10:67607148-67607170 CTTGAGCAACTCAAGGGCTAGGG + Intronic
1072026353 10:91463057-91463079 CTTGAACAATGCGAGGGTTAGGG + Intronic
1077622531 11:3740078-3740100 CTTGGACAACATGAGGGTTAGGG - Intronic
1078636381 11:13054335-13054357 CTGCAACCTCACGAGGGCCATGG + Intergenic
1078781114 11:14440472-14440494 CTTGAACAACATGGGGGTTAAGG - Intergenic
1081089410 11:38844700-38844722 CTGGAACAACAAGAGGCCCTGGG - Intergenic
1081156115 11:39693235-39693257 CTTGAACAACATGAGGATTAGGG - Intergenic
1084386755 11:68847944-68847966 CTTGCCCAACACCAGGGCCAGGG + Intergenic
1085659235 11:78347854-78347876 CTTGAACAACATGGGGGTTAGGG + Intronic
1088823105 11:113473565-113473587 CTAGAACCAAATGAGGGCCAGGG - Intronic
1088940612 11:114451698-114451720 CTTGAACAACACGGGGGTTAGGG - Intergenic
1089579417 11:119471996-119472018 CTTGAACAACAAGGGGTCAAGGG + Intergenic
1089592041 11:119547826-119547848 CTTGAACAAAACTTGGGCAAAGG + Intergenic
1096755870 12:53799090-53799112 CCTGAGCAACACAATGGCCAAGG - Intergenic
1098698321 12:73589013-73589035 CTTAAACAACACAATGGCCTAGG - Intergenic
1098734668 12:74084182-74084204 CTTAAACAACATGAGGGTGAGGG + Intergenic
1099267878 12:80470621-80470643 CTTCAACAACAGAAGGGCGAGGG + Intronic
1100003070 12:89860703-89860725 CTTGAACAACTCAAGGGTTAGGG + Intergenic
1100647196 12:96544036-96544058 CTTGAACAATATGAGGGTTAGGG + Intronic
1102202733 12:111068767-111068789 CCTGTCCAACAGGAGGGCCATGG - Intronic
1103507446 12:121451462-121451484 CTTGAACAACACAAGGGTTGGGG - Intronic
1107121595 13:36802112-36802134 CTTGAACAACACAGGGGTTAGGG + Intergenic
1109188552 13:59298748-59298770 CTTGAACAACATGAGGGTTAGGG + Intergenic
1110180109 13:72606411-72606433 CTTGAACAAAACAAGGGTTAGGG - Intergenic
1110474827 13:75901758-75901780 GTGGAACAACAGGAAGGCCATGG - Intergenic
1110525016 13:76525952-76525974 CTTGAACAACACAGTGGCCCAGG - Intergenic
1110562850 13:76927756-76927778 CTTGAACAACATGGGGGTTATGG + Intergenic
1112245075 13:97725942-97725964 CTTGAACAACACAGGGGTTAGGG + Intergenic
1112557195 13:100479346-100479368 CTTGAACAATATGGGGGCTAGGG + Intronic
1113477937 13:110598645-110598667 CTTGTCCAACCCGAGGCCCACGG + Intergenic
1116663821 14:47749032-47749054 CTTGAACAACACGGGAGTTAAGG - Intergenic
1118899970 14:69978327-69978349 CTTACACAACAAGAGAGCCAAGG - Intronic
1120695027 14:87635162-87635184 CTTGAACAACACGGGAGTTAAGG + Intergenic
1120791223 14:88585079-88585101 CTTAAACAATATGAGGGCTAAGG - Intronic
1121148624 14:91608854-91608876 CTTGAACAACACAGGGGTTAGGG + Intronic
1121447266 14:93987132-93987154 CTGGAACACCAGGAGGGCCACGG - Intergenic
1121488135 14:94336034-94336056 CTTGAACAACATGGGGGTTAGGG + Intergenic
1122179067 14:99942569-99942591 CTTGAACAACACAGGGGTTAGGG + Intergenic
1122694387 14:103545680-103545702 CTTTACCAACAGGAGGCCCATGG + Intergenic
1125252476 15:37721258-37721280 CTTGAAAAACACCATGGTCAGGG - Intergenic
1125876506 15:43151542-43151564 CTTGAACAACACCTGGTACACGG - Intronic
1126072260 15:44875400-44875422 CTTGAAAAGCACCAGGGACAGGG + Intergenic
1127697355 15:61463362-61463384 TTTGAACAACATCAGGGCCTTGG - Intergenic
1127954625 15:63842538-63842560 CTTGAACAATACAAGGGCTGGGG + Intergenic
1129813088 15:78526592-78526614 CTTGAACAACAGGGAGGCCAGGG + Intronic
1130366487 15:83244497-83244519 CTTAAACAACACAGGGGCTAGGG + Intergenic
1131455620 15:92580376-92580398 CTGGAAGGACACGAGAGCCACGG + Intergenic
1138944164 16:61827777-61827799 CTTGAACAACACGGGAGGTAAGG + Intronic
1139830008 16:69789825-69789847 CTTGAACAGCATGAGGGTCAGGG + Intronic
1143869496 17:9948197-9948219 CTTGAACAACATGGGAGCTAGGG - Intronic
1145780038 17:27556918-27556940 CCTAAACAACAGGAGGGCTAAGG - Intronic
1146245339 17:31276850-31276872 CTTGAACAACACTGGGGTTAGGG + Intronic
1146947768 17:36885371-36885393 TTAGAACAACACCAGGCCCAGGG - Intergenic
1148795480 17:50194810-50194832 CTTGAACACCAACAGGGCCCTGG + Exonic
1148909831 17:50935458-50935480 CTTGACCAGCCAGAGGGCCAGGG - Intergenic
1149526636 17:57361111-57361133 CTTGAACAACTCAAGGGTTACGG + Intronic
1151547055 17:74799571-74799593 CTTGAAGAAGTGGAGGGCCAGGG + Intronic
1152564110 17:81092524-81092546 CTTGAACAACAGGAGGCCCCCGG - Intronic
1153781451 18:8498658-8498680 CTTGAACAACACAGGAGTCAGGG + Intergenic
1155918433 18:31578649-31578671 CTTTAACAACAAGAAGTCCAAGG - Intergenic
1157398751 18:47367914-47367936 CTTGAACAACAAGAGGGTTAGGG + Intergenic
1158761691 18:60397213-60397235 CTTGAACAACTTGAAGGTCAGGG - Intergenic
1160490266 18:79331924-79331946 CTTGAACAACACGAGGGCCAGGG + Intronic
1161663554 19:5561400-5561422 CTGGAACAACAGGAGGGGAAGGG + Intergenic
1164972061 19:32541094-32541116 CTTGATCAACACGAAGGAAAGGG + Intergenic
931183401 2:59926448-59926470 CTTCAAGAAGAGGAGGGCCAGGG - Intergenic
932864125 2:75323980-75324002 CTTGAACAACACAGGGGTTAGGG - Intergenic
935037301 2:99390970-99390992 CTTGAACAACATGAGGGCTAGGG + Intronic
935316417 2:101839148-101839170 CTTGACCAAGGCTAGGGCCATGG + Intronic
935323814 2:101915946-101915968 CTTGAACAATGCGAGGGTTAGGG - Intergenic
935473680 2:103491126-103491148 CTTGAACAACACAAGTGTTAGGG - Intergenic
936984998 2:118300616-118300638 CTTCAACAACACAGGAGCCAGGG + Intergenic
936992643 2:118382630-118382652 CTTGAACAACACAAGGGTGAGGG - Intergenic
937110347 2:119362359-119362381 CTTGAACAACACAGGGGTTAGGG - Intronic
937342979 2:121103801-121103823 GTTCAAAAACTCGAGGGCCATGG + Intergenic
937892199 2:126947291-126947313 CTTTAAGCACACGATGGCCAAGG - Intergenic
938083587 2:128383704-128383726 CTTGAACAACACGGGAGTTAGGG - Intergenic
939084667 2:137705069-137705091 CTTGAACAACGTGAAGGCTAAGG - Intergenic
941838155 2:170049026-170049048 CTTGAACAACACAGAGGCTAAGG + Intronic
941981923 2:171467793-171467815 CTTAAACAACATGAGGGTTAGGG - Intronic
942264039 2:174202956-174202978 CTTGAACAACACAGGGGTTAAGG - Intronic
943296005 2:186140049-186140071 CTTGAACAACATGAGGGTTAAGG + Intergenic
945138389 2:206655735-206655757 CTTGAACAACCAGTGGGTCAAGG - Intronic
946608024 2:221427200-221427222 CCTGACCAGCACGAGTGCCAAGG + Intronic
948926305 2:241100863-241100885 CTTGAACAACACAGGGGTTAGGG - Intronic
1168813594 20:721842-721864 CTTGAACAGAACCAGGGTCATGG - Intergenic
1169451488 20:5715690-5715712 CTTGAACAACACAGGGGCTAGGG + Intergenic
1170132517 20:13036657-13036679 CTTGAACAACATGGGGGTTAAGG - Intronic
1170322609 20:15116881-15116903 CTTGAACAACACAGGGGTTAAGG - Intronic
1173212110 20:41042653-41042675 CTTGAACAACACGAGGGTTAGGG + Intronic
1175484269 20:59333944-59333966 CTGATAAAACACGAGGGCCAGGG - Intergenic
1175979139 20:62728229-62728251 CTTGATCAACAGGAGGGAGATGG + Intronic
1179520114 21:41937594-41937616 CTTGAACAGCATGAGGGTTAGGG - Intronic
1182373907 22:29832135-29832157 CAAGAATGACACGAGGGCCATGG - Intronic
1185051374 22:48555950-48555972 CTAGAACAAGAAGAGGGCCCTGG - Intronic
953041683 3:39261161-39261183 CTTCATCCACAGGAGGGCCAAGG - Intergenic
953297121 3:41730040-41730062 TTTGAACAACAGAAGGGTCAAGG + Intronic
956699149 3:71943457-71943479 CTTGAACAACATGGAGGCTAAGG + Intergenic
957347918 3:78985501-78985523 CTAGAACAACACTGGGGCCAGGG - Intronic
957833667 3:85556003-85556025 CTTGAAGAACACAAGGATCAGGG + Intronic
957844911 3:85719342-85719364 CTTGAACAACATGGGGGTTAGGG + Intronic
957969988 3:87370975-87370997 ATTAAAGAACACGAGAGCCAAGG - Intergenic
958673789 3:97239358-97239380 CTTGAACAACATGGGGGTTAGGG + Intronic
958784200 3:98579355-98579377 CTTGAACAACATTAGGGCTAGGG - Intronic
959601141 3:108187071-108187093 CTTGAACAACATGAAGGTTAGGG - Intronic
959640651 3:108628826-108628848 CTTGAACAGTATGGGGGCCATGG - Intronic
959839814 3:110961418-110961440 CTTGAACACAACCAGGGGCAGGG + Intergenic
960755787 3:121010554-121010576 CTTGAACAACACGGGGGTTAGGG + Intronic
962901991 3:139769488-139769510 CTTGAAAAAAAGGAGGGCCTCGG + Intergenic
963517474 3:146326482-146326504 CTTGAACACCACTAGACCCAGGG - Intergenic
963664212 3:148161786-148161808 CTTGAACAACATGAGGGTTAGGG - Intergenic
965392559 3:168122470-168122492 GTTGAACAACATGAGGGTTAGGG + Intergenic
965543565 3:169893341-169893363 CTTGAACAACATGGGGGTCAGGG + Intergenic
965611379 3:170547317-170547339 CTTGAACAACACTGGGGCTAGGG + Intronic
966282598 3:178250188-178250210 CTTGAACAACATGGGAGCTAGGG + Intergenic
977099657 4:92794724-92794746 CTTGAACAACATAAGGTCTAGGG + Intronic
979564293 4:122136820-122136842 CTTGAACAACACAGGGGTTAGGG - Intergenic
979816685 4:125114982-125115004 CTCGAACAACACAAGGGTTAGGG - Intergenic
981983671 4:150828112-150828134 CTTGAACAACATGGGGGTTAGGG - Intronic
982112312 4:152068017-152068039 CTTGACTAAGACGAAGGCCAAGG - Intergenic
983539592 4:168895044-168895066 CTTGAACAACACGGGAGTTAGGG + Intronic
984153592 4:176165421-176165443 CTTGAACAATATGAGGGTTAGGG + Intronic
984172849 4:176381503-176381525 CTTGTACAACCCAAGGCCCATGG + Intergenic
985223418 4:187732343-187732365 CTTGAACAACGTGAGGGTGAAGG - Intergenic
987281438 5:16417919-16417941 CTTGAACAACATGGGGGCTAAGG + Intergenic
987614801 5:20259757-20259779 CTTGAACAACACAGGGGCTAGGG - Intronic
988408642 5:30857250-30857272 CTTGAACAGCAAGAGGGAGAAGG - Intergenic
988573521 5:32396257-32396279 CTTGAACAACATGGAGGTCAGGG - Intronic
989364634 5:40642105-40642127 CTTGAACAACATGGGGGTGAGGG - Intergenic
989483708 5:41963436-41963458 CTTGAACAACGTGAGGGTTAGGG + Intergenic
991397080 5:66215372-66215394 CTTGAACAACATGGGGGTAAGGG - Intergenic
991563884 5:67984584-67984606 CTTGAACAACATGGGGGTGAGGG + Intergenic
992122049 5:73604741-73604763 CTTGAACAACACAGGGGTTAGGG - Intergenic
992990875 5:82281996-82282018 CTTGAACAACATGGGGGTTAGGG - Intronic
994501384 5:100582880-100582902 CTTGAATAACATGGGGGCTAGGG + Intronic
996687501 5:126299692-126299714 CTTGTCCAACCCAAGGGCCATGG - Intergenic
996844741 5:127886785-127886807 CTTGAACAACACAGGGGTTAAGG - Intergenic
997037303 5:130208198-130208220 CTTGAACAACACAGGGGTCTAGG + Intergenic
998031037 5:138868293-138868315 CTTGAACAACACTGGGGTTAGGG - Intronic
1002817126 6:691699-691721 CTTGAACAACACTGGGGTTAGGG - Intronic
1003532242 6:6947440-6947462 CTTGAACAACATGAGAGTCAGGG - Intergenic
1005881498 6:30065639-30065661 CTTGAACAACATGGGGGTAAGGG - Intergenic
1007089678 6:39174757-39174779 TTTGAACAACATGGGGGCTAGGG - Intergenic
1007634469 6:43290057-43290079 CTTGAACAACACAGGGGTTAGGG + Intergenic
1008124070 6:47649263-47649285 CTTGAACAACATGGGGGTTAGGG - Intergenic
1009249020 6:61275442-61275464 CCAAAACAACACGAGGGCGAGGG - Intergenic
1009304327 6:62069086-62069108 CTTGAACAACATGGGGGTTAGGG + Intronic
1010627072 6:78151381-78151403 TTTGAACAACATGAGGGTTAGGG - Intergenic
1011440442 6:87381302-87381324 CCTGAACAACCCGAAGGCCGGGG + Intronic
1013329940 6:109090347-109090369 CTTGAACAACAAGGGGGTTAGGG + Intronic
1017586718 6:155934824-155934846 CTTGAACAACATGAAGGTTAGGG - Intergenic
1017694872 6:157004496-157004518 CTCGAAGAACACTGGGGCCATGG + Intronic
1018905177 6:168071830-168071852 CTTGAGCAACAGGAGGGGCTGGG - Intronic
1018973904 6:168549302-168549324 CTTGAACAACATGGGGGTGAGGG + Intronic
1020017715 7:4841220-4841242 CTTGAAGAAGACGAGGGCGTTGG - Intronic
1021201613 7:17734033-17734055 CTTGAACAACACAAGGGTTGAGG - Intergenic
1021849783 7:24796177-24796199 CTTGAACAACACAGGGGCTAGGG - Intergenic
1023047346 7:36222057-36222079 CTTGAACAACATGGGGGTTAGGG + Intronic
1026595031 7:71727252-71727274 CTTGAACAATCAGTGGGCCATGG + Intergenic
1027275982 7:76556485-76556507 CTTGAACATTTAGAGGGCCATGG - Intergenic
1030711738 7:112757825-112757847 TTTGAACTTCACTAGGGCCATGG - Intergenic
1030791093 7:113729999-113730021 CTTGAACAACTGGAGGGTTAAGG - Intergenic
1032074699 7:128830939-128830961 CTCGAGGAACTCGAGGGCCACGG - Exonic
1032765094 7:134984308-134984330 CTTGAACAACTCGGGGGTTAGGG - Intergenic
1034238803 7:149593835-149593857 CTTGAACAACACAGGGGCCAGGG - Intergenic
1034242240 7:149619594-149619616 CTTGAACAACACAGGGGCCAGGG - Intergenic
1037328425 8:17718764-17718786 CTTGAACCACACTTTGGCCATGG - Intronic
1037749286 8:21669935-21669957 CTTGAACAACACAGGGGTTAGGG - Intergenic
1038591405 8:28841596-28841618 CTTGACCAACACAGGGGTCAGGG + Intronic
1039769531 8:40669796-40669818 CTTGAACAACACAAGGATCAGGG - Intronic
1040279425 8:46031322-46031344 CTTTACCAACATGCGGGCCAGGG + Intergenic
1040797622 8:51303275-51303297 CATGAACAACACTTGGCCCAGGG + Intergenic
1041612361 8:59866385-59866407 CTTGAACAAAACAAAGGTCAGGG + Intergenic
1041779248 8:61559395-61559417 CTTGAACAACACAGGGGTTAGGG - Intronic
1043077806 8:75723683-75723705 CTTGAACAACACTGGGGCTGCGG - Intergenic
1043962879 8:86437615-86437637 CTTAAACAACACAGGGGCTAGGG + Intronic
1044762008 8:95529696-95529718 CTTGAACAACATGGGGGTTATGG + Intergenic
1046115688 8:109780629-109780651 CTTGAACAACATGGGGGTTAGGG - Intergenic
1048800646 8:138191099-138191121 CTTCATCAACACCAGGCCCATGG + Intronic
1049483632 8:142839970-142839992 GCTCAGCAACACGAGGGCCAAGG - Intronic
1050833699 9:10048975-10048997 CTTGAACTACCCGAGTGTCAGGG - Intronic
1052039515 9:23721985-23722007 CTTGAACAATTCGGGGGCTATGG - Intronic
1052322286 9:27181092-27181114 CTTAAACAACATGGGGGCTAGGG + Intronic
1053169139 9:35866246-35866268 CCTGAACAACACGGGGGTGAGGG - Intergenic
1055031335 9:71773627-71773649 CTTAAACAACACGAGGGTTAAGG + Intronic
1055229121 9:74040367-74040389 CTTGAACAACACAAGGGTTAGGG - Intergenic
1056085020 9:83139299-83139321 CTTGAACAACATGGGGGCTTGGG + Intergenic
1056527925 9:87460750-87460772 GTTAAACAACACAAGGGCTAGGG - Intergenic
1056731434 9:89169602-89169624 CTTGACCCACACCAGGGCAAAGG + Intronic
1060190884 9:121591776-121591798 CTTGAACTACACCCAGGCCATGG - Intronic
1185713087 X:2319797-2319819 CTTGAACAACACGGGGGTTAGGG - Intronic
1186900745 X:14052815-14052837 CTTGAACAACATGAGGGTTAGGG + Intergenic
1189715032 X:43856486-43856508 CTTGAACAACACAAGGGTTAGGG + Intronic
1190484207 X:50908534-50908556 CTTGAACAACATGGGGGTTAGGG - Intergenic
1194236712 X:91393378-91393400 CTTGAACAATATGAGGATCAGGG - Intergenic
1194658736 X:96604524-96604546 CTTGAACAACATGGGGGTCAGGG - Intergenic
1194809578 X:98374361-98374383 CATCAACATCACGAAGGCCAAGG + Intergenic
1195207298 X:102615032-102615054 CTTGAACAACACAGGGGTTAGGG - Intergenic
1195455067 X:105058916-105058938 CTTGAACAACATGAGGGTTGGGG + Intronic
1195873614 X:109514268-109514290 CTTGAACAATGCAAGGGACAGGG + Intergenic
1196065471 X:111459451-111459473 CTTGAACAACACAAGGGTTAGGG - Intergenic
1196387457 X:115174107-115174129 CTTGAACAACATGAGGGTTAGGG - Intronic
1197426823 X:126307123-126307145 CTTGAACAACACTGGGGCTAGGG + Intergenic
1197676187 X:129333381-129333403 CTTGAACAGCACAAGGGTTAGGG + Intergenic
1198816666 X:140598856-140598878 CTTGAACAACACAAGGGTTAAGG - Intergenic
1199032624 X:143018042-143018064 CTAGAACAGCACTAGGGCAATGG - Intergenic