ID: 1160495973

View in Genome Browser
Species Human (GRCh38)
Location 18:79375635-79375657
Sequence CTGAGTGAGGGGAAGGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 859
Summary {0: 1, 1: 0, 2: 12, 3: 76, 4: 770}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160495963_1160495973 -1 Left 1160495963 18:79375613-79375635 CCTGTTCAGGGGCTTGGTGGCCC 0: 1
1: 0
2: 0
3: 14
4: 167
Right 1160495973 18:79375635-79375657 CTGAGTGAGGGGAAGGGGCCGGG 0: 1
1: 0
2: 12
3: 76
4: 770

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160495973 Original CRISPR CTGAGTGAGGGGAAGGGGCC GGG Intronic
900035297 1:402694-402716 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
900056918 1:638447-638469 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
900135679 1:1116037-1116059 GTGAGTGAGGGGCTGGGGGCAGG - Intronic
900155230 1:1201204-1201226 CCGGGTGCGGAGAAGGGGCCGGG - Intergenic
900204814 1:1427356-1427378 GTGATGGAGGGGAAGGGGCAGGG - Intronic
900368709 1:2322067-2322089 GCGGGTGTGGGGAAGGGGCCAGG - Intronic
900372481 1:2338087-2338109 CTGAGTGAGTGGAGGGGCGCTGG + Intronic
900415474 1:2532632-2532654 CTGGCTCAGGGGAAGGGACCAGG - Intergenic
900541652 1:3205956-3205978 CTGAGTCAGGGCAGGGGGCTGGG - Intronic
900580536 1:3406434-3406456 CGGAGTGAGAAGAAAGGGCCAGG + Intronic
900593833 1:3471537-3471559 CTGGGGGAGGGGGAGGGGTCTGG + Intronic
900659527 1:3775693-3775715 CTGGGTCAGGGGGAGGGGCCTGG - Intronic
901215104 1:7550709-7550731 AGGAGTCAGGGGGAGGGGCCAGG - Intronic
901457786 1:9373279-9373301 GTGACTGGGGAGAAGGGGCCTGG + Intergenic
901860765 1:12072949-12072971 CTATGTGTGGGGAAGGGGCAGGG - Intronic
902255422 1:15186070-15186092 CTGAGTGGGAGGAGGGGGCAGGG - Intronic
902263508 1:15245035-15245057 GTGAGCGAGGGGGAGGTGCCAGG + Intergenic
902292105 1:15442298-15442320 CAGGGTGAGGGGAAGGGCCTGGG - Intronic
903224197 1:21885646-21885668 TGGAGTGAGGGGTGGGGGCCGGG - Intronic
903322792 1:22552796-22552818 CGGGGTGAGGGGAGGGTGCCAGG + Intergenic
903377271 1:22874658-22874680 CTGATTGTGACGAAGGGGCCTGG + Intronic
903493040 1:23743775-23743797 GTGAGGGAGGGGGAGCGGCCGGG - Intronic
903651643 1:24926156-24926178 CTGACTGCGGGGCAGTGGCCAGG - Intronic
903827262 1:26155300-26155322 CTCAGTGAGGGCAAGAGGCCAGG - Intergenic
904237918 1:29125798-29125820 CTGAGGGAGTGTAAGAGGCCCGG - Intergenic
904400484 1:30253579-30253601 CTGGGAGAGGGGAGGTGGCCTGG + Intergenic
904490823 1:30858054-30858076 CTGAGGGAGGGGACAGGGGCAGG - Intergenic
904497094 1:30893144-30893166 CTGAGGGTGGGGAAGGTGCAGGG + Intronic
904700986 1:32357954-32357976 CTGAGGAATGGGGAGGGGCCAGG - Intronic
905037121 1:34925511-34925533 CTGAGTGAGGGGAGGGGAGAGGG + Intronic
905236692 1:36554893-36554915 CTGAGTGACATGAAGGAGCCAGG - Intergenic
905337032 1:37251878-37251900 ATGTCTCAGGGGAAGGGGCCTGG + Intergenic
905394224 1:37657032-37657054 CTGGGTGACTGCAAGGGGCCAGG - Intergenic
906185400 1:43858645-43858667 CTCAGTGAGAGGGAGGGCCCAGG + Intronic
906346356 1:45017788-45017810 GTGAGTGAGGGACAGAGGCCAGG - Exonic
906407148 1:45551019-45551041 CGGAGGGAGGGGCAGGGGCCGGG - Exonic
906535447 1:46548613-46548635 GGGAGGGAGGGGAAGGGGCAGGG + Intronic
906699803 1:47849719-47849741 CTAAGTGAGGGGATGGGGTGCGG + Intronic
907341931 1:53741187-53741209 CTCACTGAGGGGAAGGGGAGGGG - Intergenic
907408671 1:54269716-54269738 CTGATGGAGGGGCAGAGGCCAGG + Intronic
908366992 1:63434725-63434747 CTGGTTTAGGGGAAAGGGCCAGG + Intronic
912435760 1:109659986-109660008 ATGAGTGAGGGGCAGGCCCCAGG - Intronic
912440181 1:109691742-109691764 GTGAGTGAGGGGCAGGCCCCGGG - Intronic
912443500 1:109716119-109716141 GTGAGTGAGGGGCAGGCCCCAGG - Intronic
912654958 1:111477739-111477761 CTGAGTGAGGATCTGGGGCCTGG - Exonic
912667214 1:111593072-111593094 CTGAGTGGGTGGAGGGGGCGGGG + Intronic
912688036 1:111782311-111782333 CTAAATGTGGGGAAGGGGCCAGG + Intronic
913161266 1:116148075-116148097 CTGAGTTGGGGTGAGGGGCCTGG - Intergenic
913178873 1:116299890-116299912 CTGAGAGAAAGGAAGGGGCTGGG - Intergenic
914899340 1:151703510-151703532 CTGGGGGAGGGGAGGGGGCTGGG + Intronic
915086989 1:153395641-153395663 TTAAGTGTGGGGAAGGGGCGAGG - Intergenic
915310672 1:155004437-155004459 GTGAGTGTGGGGATGAGGCCTGG + Intronic
915366967 1:155322071-155322093 CTGAGTGAGGAGGAGCAGCCTGG - Exonic
915977937 1:160402660-160402682 CTGTGTGTCGGGAAAGGGCCAGG + Intronic
916091338 1:161309908-161309930 CTGGGGCAGGGGCAGGGGCCCGG + Exonic
916496493 1:165352783-165352805 CCGAGTCAGAGAAAGGGGCCTGG + Intronic
916717273 1:167456009-167456031 CTGAGGAAGGGGGAGGGGGCGGG - Intronic
916741461 1:167650431-167650453 CTGAGTGAGTGGTCTGGGCCTGG - Intronic
917483311 1:175432050-175432072 CTGCCTGTGGGGAGGGGGCCAGG + Intronic
917837706 1:178954012-178954034 CTGGGAGAGGGGAATGAGCCTGG - Intergenic
918213210 1:182370143-182370165 TTGGGTGAGGGGCAGGGGACAGG + Intergenic
919762492 1:201106761-201106783 CTGAGTGAAGGGGAGATGCCTGG - Intronic
919982487 1:202650969-202650991 CAGAGTGGGAAGAAGGGGCCGGG + Intronic
920123583 1:203676349-203676371 CTGAGGGATTGGAAGTGGCCAGG + Intronic
920387401 1:205578722-205578744 CTGAGAGAGGGGAGGGGGAAAGG - Intronic
920711433 1:208298952-208298974 CTGGGGGAGGGAAAGGGGCTGGG + Intergenic
921094205 1:211873185-211873207 CTGCGTGAGGAGAAGTGGCTGGG - Intergenic
921260453 1:213381459-213381481 CTGAATGAGAGGAGGGGGGCAGG + Intergenic
922257827 1:223908254-223908276 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
922719471 1:227893016-227893038 GGGAGAGTGGGGAAGGGGCCTGG - Intergenic
923202262 1:231724168-231724190 CTCTGTGTGGGGAAGGGGGCAGG + Intronic
924239481 1:242027364-242027386 CCCAGTGAGGGGAAGGGGACAGG + Intergenic
924339025 1:243011033-243011055 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
924589912 1:245393925-245393947 CTGGGGGAGGGGAAGGGGTCAGG + Intronic
1063008163 10:1994696-1994718 GGGAGTGAGGGGCAGGGGCTGGG + Intergenic
1063885737 10:10576677-10576699 CTGAAGGAGGTGAAGGGGCTAGG - Intergenic
1063935519 10:11073717-11073739 CTGACTGAGGAGAAGGGGCCAGG + Intronic
1064173178 10:13051772-13051794 AGGAGTGAAGGGAAGGGGCATGG + Intronic
1066610674 10:37244886-37244908 CAGAGTGAGGAGTTGGGGCCTGG - Intronic
1067227886 10:44387062-44387084 CTGCGGGAGGGGCAGCGGCCAGG - Intergenic
1067435178 10:46272091-46272113 CTGAGTCAGGGTCAGGGGTCTGG - Intergenic
1067438539 10:46295225-46295247 CTGAGTCAGGGTCAGGGGTCTGG + Intronic
1067479460 10:46585475-46585497 CTGTGTGAGGGGTGGGGCCCTGG + Intronic
1067479696 10:46586921-46586943 CCGAGAGAGTGGGAGGGGCCAGG + Intronic
1067615041 10:47754876-47754898 CCGAGAGAGTGGGAGGGGCCAGG - Intergenic
1067615278 10:47756323-47756345 CTGTGTGAGGGGTGGGGCCCTGG - Intergenic
1067768671 10:49108383-49108405 CTTGGGGAGGGGCAGGGGCCAGG - Intronic
1067777506 10:49174244-49174266 CTGAGGCAGGGGCAGGGGCAGGG - Intronic
1068303537 10:55176180-55176202 CTGAGGGAGGAGAAGAAGCCTGG - Intronic
1068508307 10:57930852-57930874 ATGAATAAGGGGAAAGGGCCAGG - Intergenic
1069299061 10:66884072-66884094 ATGAGAGAGGGGGAGGTGCCAGG + Intronic
1069555473 10:69394927-69394949 CTGAGACAGGAGGAGGGGCCTGG - Intronic
1069680681 10:70283495-70283517 CTGAGTGAGGGAGAGAGACCTGG - Intronic
1069904844 10:71726217-71726239 CTGGTTTAGGGGAAGGGGCTGGG - Intronic
1070311259 10:75275724-75275746 CAGACTGAGGGCAAGGGGGCTGG + Intergenic
1070312606 10:75284423-75284445 CTGGGTTGGGGGAAGGGGACTGG + Intergenic
1070418085 10:76208782-76208804 CAGAGTGTGGTGAAAGGGCCTGG - Intronic
1070682650 10:78459689-78459711 GTGAGTGAGGGGATGGGGTTAGG + Intergenic
1070741583 10:78907048-78907070 CTGTGTGGAGGGAAGGGGACAGG - Intergenic
1070855735 10:79606853-79606875 CTAAGAGAGGAGAGGGGGCCTGG + Intergenic
1071008319 10:80909463-80909485 GGGAGTGAGGGGGAGGTGCCAGG + Intergenic
1071229918 10:83573605-83573627 CTGTGTGATGGGAAGGCACCTGG - Intergenic
1071491463 10:86139387-86139409 CAGAGGGAGGTGAAGGGGACTGG - Intronic
1071630679 10:87216274-87216296 CTGTGTGAGGGGTGGGGCCCTGG - Intergenic
1071669119 10:87590692-87590714 CTGTTTGCGGGGAGGGGGCCTGG - Intergenic
1071847692 10:89536475-89536497 ATGAGTGAGGTGTAGGCGCCCGG + Intronic
1072036817 10:91570381-91570403 AAGAGAGAGGGGGAGGGGCCAGG - Intergenic
1072658246 10:97345732-97345754 CTGAGTGAGTGGGAGGGGTGTGG - Intergenic
1072686445 10:97540046-97540068 CTGAGGAAGGGGGAGGGGCATGG + Intronic
1072751034 10:97979004-97979026 CTGAGTGAGGAGATGGGGGCAGG + Intronic
1073047124 10:100646126-100646148 CTGAGGGAGGGGAGGAGGCTGGG + Intergenic
1073121647 10:101125602-101125624 CTGATTGAGAGGAATGGGCAGGG + Intronic
1073330856 10:102669119-102669141 CTCAGGGCGGGAAAGGGGCCTGG + Intergenic
1073442100 10:103558249-103558271 GTGAGTGAGGGGAGGGTGACAGG + Intronic
1074893618 10:117755952-117755974 ATGAGTGAGGGGGTGGGGGCTGG - Intergenic
1075262880 10:120978104-120978126 CTGAGGGTGGGGAAGGGGAGAGG + Intergenic
1075420956 10:122299895-122299917 CTGTGTGAGTTGAAGGAGCCAGG - Intronic
1075558139 10:123448065-123448087 ATGAGTCTGGGGAGGGGGCCTGG + Intergenic
1075592538 10:123703126-123703148 CCCAGAGAGGGGAAGGGACCTGG + Intergenic
1075656855 10:124167768-124167790 CTGAGGGAGGGGGAGGGTGCAGG + Intergenic
1075667692 10:124242768-124242790 CTGAGTGAGGATGAGGGTCCTGG - Intergenic
1075733884 10:124652437-124652459 CTTAGAGAGAAGAAGGGGCCCGG + Intronic
1075747236 10:124736435-124736457 CTGGGTGAGGAGAAGGAGCCTGG - Intronic
1076022913 10:127089188-127089210 CTGAGTCACGGGAGGGGTCCAGG - Intronic
1076601471 10:131659377-131659399 CTGTGTCTGGAGAAGGGGCCAGG + Intergenic
1076707618 10:132310227-132310249 CTGACTGAGAGGCAGGTGCCTGG - Intronic
1076740035 10:132478446-132478468 CTGCTGCAGGGGAAGGGGCCAGG - Intergenic
1076775956 10:132698310-132698332 GTGAGTGTGGGGCAGGGGCACGG + Intronic
1076796001 10:132798813-132798835 GTGAGGTAGGAGAAGGGGCCTGG + Intergenic
1077161202 11:1113463-1113485 CTGAGTGGGCAGAAGGGGCGGGG - Intergenic
1077902749 11:6502941-6502963 CAGGGGGAGGAGAAGGGGCCTGG - Intronic
1078340473 11:10495111-10495133 CAGAGGGAGGGGAAGGGGCCAGG - Intronic
1078447686 11:11416885-11416907 CTGGGGGAGGGGATGGGGCAGGG - Intronic
1078672304 11:13376318-13376340 CTGTGTGAGGGGCCGGGGCTAGG + Intronic
1078935946 11:15950311-15950333 CTGAATCTGAGGAAGGGGCCTGG - Intergenic
1079360314 11:19765451-19765473 CAGAGGGAGGGGAAGGGGAAGGG - Intronic
1079831528 11:25275470-25275492 TTGAGTGGGGGGTAGGGGCACGG - Intergenic
1080034684 11:27699774-27699796 CTGACTGAGGGGAGGGTGCTGGG - Intronic
1083307566 11:61769233-61769255 GAGAGCCAGGGGAAGGGGCCGGG - Intronic
1083672123 11:64305596-64305618 CCGAGTGAGGGGACGCGGCGCGG + Intronic
1084116537 11:67045888-67045910 CTGGGGGATGGGAAGGGGCCAGG + Intronic
1084296627 11:68216404-68216426 CCGAGTCAGCGGAAGGGGCCCGG + Intergenic
1084651514 11:70492109-70492131 CTGAGTGAGCGGTAAGGGCAGGG + Intronic
1084684395 11:70685302-70685324 ATGAGTGAAGGGGAGGAGCCAGG - Intronic
1084857425 11:71997967-71997989 CTCAGAGAGGGGAATGGGGCTGG + Intergenic
1084941977 11:72617829-72617851 CAGAGAGAGGGAAAGGGGGCAGG - Intronic
1084943965 11:72629049-72629071 ATGAGTGTGGGGATGGGGTCAGG + Intronic
1085068188 11:73517387-73517409 CTGCATGAGGGGAAGGGGGGTGG - Intronic
1085315012 11:75539573-75539595 GTGAGAGTGGGGAAGAGGCCTGG + Intergenic
1085566989 11:77523074-77523096 CTGAGAGAGGGAAAGGGGCAAGG + Intronic
1085744218 11:79100899-79100921 CTGGGGGATGGGAAAGGGCCTGG - Intronic
1088401404 11:109424634-109424656 CAAAGGGAGGGGAGGGGGCCCGG + Exonic
1088626321 11:111733015-111733037 CTGACTGAGGCGAAGGGGCTGGG + Intronic
1088822011 11:113464447-113464469 GTGAGGGAGGGGAAGTGACCAGG - Intronic
1088920598 11:114257708-114257730 CTGAGGGAGGGGAGGGGAGCTGG - Intergenic
1089163521 11:116457672-116457694 CTGAGGAAGGGGAAGAGGCAGGG + Intergenic
1089303483 11:117512602-117512624 CTGAGGGTGGGGAAGGGGGAAGG + Intronic
1089430293 11:118418009-118418031 ATGAGTCAGGGGTAGGGGACTGG + Intronic
1089538173 11:119173435-119173457 ATGTGTCAGGGAAAGGGGCCTGG - Intronic
1089688107 11:120169630-120169652 CTCAAAGAGGGGAAGTGGCCAGG - Intronic
1089709729 11:120306316-120306338 CTCAGTGAGGGGTGGTGGCCGGG + Intronic
1090188271 11:124752061-124752083 CTGAGTGGTGAGGAGGGGCCGGG - Exonic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090872900 11:130763589-130763611 CTGAGGGAGGTGATGGGGCTTGG - Intergenic
1090927361 11:131260435-131260457 CTGAGTGTGACCAAGGGGCCAGG + Intergenic
1091084778 11:132710910-132710932 ATGAGAGAGGGTAAGGGGTCTGG + Intronic
1091345186 11:134847585-134847607 ATGTGTGAGGGGAGGGGTCCCGG + Intergenic
1091532652 12:1374450-1374472 CTGCATCAGAGGAAGGGGCCAGG + Intronic
1091658934 12:2367119-2367141 CTGACTGAAGGGATGGGGGCAGG + Intronic
1091787977 12:3254425-3254447 CTGACCCAGGGGAAGGGGCAAGG - Intronic
1092120921 12:6043347-6043369 CTGCTTGAGGGGAAGTGTCCTGG - Intronic
1092258957 12:6942207-6942229 ATTAGTGTGGGGAAGGGGCAAGG - Exonic
1093996287 12:25646327-25646349 CAGAGTGATGGGAGAGGGCCAGG - Intronic
1094141057 12:27182442-27182464 TCCAGTGAGGGGAAGGGGGCTGG + Intergenic
1094719999 12:33053121-33053143 CTGCCTGAGGGCAAGGGGCCAGG - Intergenic
1095376418 12:41534437-41534459 AGGAGTGAGGGGAAGGGGGAAGG - Intronic
1095709891 12:45277120-45277142 GTGAGAGAAGGGAAGGGGGCTGG - Intronic
1095958297 12:47819044-47819066 CTGTGTGAGGGGTGGGGGACAGG - Intronic
1096073718 12:48789370-48789392 CGGGGTGAAGGGAAGGGGACCGG - Intergenic
1096115824 12:49054505-49054527 GTGAGTGAGGAGAATGGGGCAGG - Intronic
1096870352 12:54588692-54588714 CTGGGGGAGGGGGAGGGGGCCGG - Intergenic
1097143106 12:56919722-56919744 CTGTCTGAGGGTAAGGGGCTAGG + Intergenic
1097178331 12:57156460-57156482 CTGAGTGGGTGGATGGGGGCTGG - Intronic
1097223416 12:57463191-57463213 CTGAGTGAGGGGAGGGGTAAGGG - Intronic
1098270196 12:68762475-68762497 CTGAGTGAGGTGGAGGGCACTGG + Intronic
1100915039 12:99410980-99411002 ATGAGTGTGGGGAAGGGTCAAGG - Intronic
1102053219 12:109878422-109878444 CTGAGTTGGGGGATGGGGCACGG - Intronic
1102959695 12:117084709-117084731 CTGAGTCAGGGGAGGGAGGCTGG - Intronic
1103763814 12:123268483-123268505 CGGAGAGAGGGGCAGGTGCCGGG - Intronic
1103905410 12:124325139-124325161 GGAAGGGAGGGGAAGGGGCCGGG - Exonic
1103942709 12:124509661-124509683 CAGTGTAGGGGGAAGGGGCCAGG + Intronic
1104010859 12:124929102-124929124 AGGAGTGAGGGGAGGGGGCAAGG + Intergenic
1104409142 12:128543634-128543656 CTGAGTGAGGAGACGGACCCAGG + Intronic
1104918344 12:132277992-132278014 GGGAGTGAGGGGGAGGGGGCCGG - Intronic
1104986969 12:132602812-132602834 CTGGGGAAGGGGAAGGGGCCTGG + Intergenic
1105316042 13:19264811-19264833 GGGAGGGAGGGAAAGGGGCCAGG - Intergenic
1105475411 13:20724391-20724413 CTTAGTGAGGTGAAGGGAGCAGG - Intergenic
1105831404 13:24165540-24165562 CTGAGAGAGGAGAAGAGGGCAGG - Intronic
1105844399 13:24281796-24281818 CTGAGAGAGGGGCTGGGGCCGGG + Intronic
1106016963 13:25878795-25878817 CAGAGTGAGTGGAAGGTGCTGGG - Intronic
1106139474 13:26999767-26999789 CTGAGATACAGGAAGGGGCCTGG - Intergenic
1106314616 13:28582426-28582448 CAGAGTGGGGGAAAGGAGCCAGG - Intergenic
1106391640 13:29339820-29339842 CTGGGAGCGGAGAAGGGGCCTGG + Intronic
1106539348 13:30675946-30675968 CTGATAGAGGGAAAGGGCCCAGG + Intergenic
1106543719 13:30713146-30713168 CCCAAGGAGGGGAAGGGGCCAGG + Intergenic
1106620052 13:31364326-31364348 CTGTGTGAGAGGAGGGGGTCAGG - Intergenic
1107052765 13:36069661-36069683 CTGAGTGAAGGCAAGGATCCAGG - Intronic
1108276980 13:48820942-48820964 GTGAGTGAGGGGAAGTGGGCTGG + Intergenic
1109272394 13:60268838-60268860 GTGAGAAAGGGGAAGGGGCCGGG + Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1112385944 13:98939702-98939724 CTCAGTGAGGGAGATGGGCCAGG - Intronic
1112462915 13:99618706-99618728 CTGGGTGGGGGGAAGGGAACAGG - Intronic
1112768827 13:102773905-102773927 CGGAGCTAGGGGAAGGTGCCAGG + Intergenic
1112771870 13:102800738-102800760 CTGAAGGGGAGGAAGGGGCCTGG + Intronic
1113120953 13:106923519-106923541 CTGAGTGATGAGAGGGGTCCAGG + Intergenic
1113156368 13:107327278-107327300 CTGAGTGAGGACAAGAGGCCAGG - Intronic
1113166376 13:107448101-107448123 CTGACTGAGAGGCAGGGGCTCGG - Intronic
1113443399 13:110347127-110347149 CTGAGTGAGGAAAGGGGGCTTGG - Intronic
1113460439 13:110478665-110478687 CTGAGTGTGGGAGAGCGGCCTGG - Intronic
1113473359 13:110562000-110562022 CCGAACGAGGCGAAGGGGCCGGG + Intergenic
1114183056 14:20381502-20381524 CTGAGTGTGGGGCTTGGGCCTGG - Intronic
1114454734 14:22847252-22847274 CTCAGTGAGGGGCAGGAGCTGGG + Exonic
1114519611 14:23324992-23325014 CTGAGTGAGAGACAGGGGCAAGG - Intronic
1114646124 14:24257192-24257214 CTGAGTGAGAGGGAGGGCACTGG + Intronic
1115508881 14:34120343-34120365 CTGAGTTAGGGCAAGGGGGCTGG - Intronic
1117533946 14:56686614-56686636 CAGAGTCAGGGGAAAGGGCACGG - Intronic
1117647238 14:57865512-57865534 CCGTGAGAGGGCAAGGGGCCCGG - Intronic
1118220794 14:63853197-63853219 GGGAGGGAGGGGAAGGGGCGGGG + Intronic
1118328946 14:64801142-64801164 CACAGTGAGGGGCAGTGGCCAGG - Intronic
1118868115 14:69719097-69719119 CAGCGTGAGGTGAAGAGGCCAGG - Intergenic
1120255019 14:82107459-82107481 AAGAGAGAGGGGAAGGGGGCTGG + Intergenic
1120818070 14:88883883-88883905 CTGTTTTAAGGGAAGGGGCCGGG - Intergenic
1120941683 14:89955845-89955867 CTCCGGAAGGGGAAGGGGCCGGG + Intronic
1121403212 14:93701078-93701100 CTGAGTGAGGAGAGGTAGCCAGG - Intronic
1121537244 14:94699322-94699344 CTCAGAGAGGGGAAGGGGTAGGG + Intergenic
1121647063 14:95525816-95525838 CTGACTGTGGGGAGGGGGCTGGG - Intergenic
1122048172 14:99038075-99038097 GGGAGTGAGGCGAAGTGGCCGGG + Intergenic
1122118606 14:99540239-99540261 CTGAGTGTGGGGAGAGGGTCAGG - Intronic
1122119511 14:99544565-99544587 CTGAGGCAGGGGATGGGGCTTGG + Intronic
1122162020 14:99791845-99791867 TGGACTGAGGGCAAGGGGCCAGG - Intronic
1122182023 14:99962300-99962322 AAGAGAGAGGGGGAGGGGCCAGG - Intergenic
1122314637 14:100818465-100818487 AGGAGGGAGGGCAAGGGGCCAGG + Intergenic
1122329195 14:100901635-100901657 CAGAGTGAGTGGAAGGAGCGAGG - Intergenic
1122647930 14:103207379-103207401 AGGAGGAAGGGGAAGGGGCCTGG - Intergenic
1122806789 14:104263874-104263896 CTGAGCCAGGGGCAGGGGTCGGG - Intergenic
1122826214 14:104372027-104372049 ATGACTGAGGGAAAGGAGCCAGG - Intergenic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931268 14:104933869-104933891 CTGAGTGAGGGGAGGGCGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1123121511 14:105919036-105919058 CTGAGTGAGGGACAGAGACCGGG + Intronic
1123712843 15:23002491-23002513 CTGAATCAGGGGAAGTGGCCCGG - Intronic
1124051088 15:26198107-26198129 GAGAGTGAGAGGAGGGGGCCAGG + Intergenic
1124610146 15:31202496-31202518 ATGGGTGAGGGGAAGTAGCCTGG + Intergenic
1124636164 15:31366321-31366343 CTTGGTGAGAGGAAGGGGGCTGG - Intronic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125543500 15:40486512-40486534 CTCAGTGATGGGGAGGGGCGTGG - Intergenic
1125685486 15:41560939-41560961 CTGGGCGAAGGGAAGGGGCATGG - Intronic
1126033690 15:44526780-44526802 CTGTGTGAGCTGAAGGGGCTGGG - Exonic
1126468520 15:48982739-48982761 ATGTGTGAGTAGAAGGGGCCAGG + Intergenic
1127071581 15:55291974-55291996 ATGAATGAGGGCAAGGGGCAAGG + Intronic
1127706327 15:61550566-61550588 ATGAGGGAGGGGAAGGAGCAGGG - Intergenic
1128073703 15:64813014-64813036 CTGCGGAAGGGGAAGGGGCTGGG + Intergenic
1128099819 15:64989680-64989702 CTGAAGGAGGGGAAGGGACGTGG - Exonic
1128346336 15:66854744-66854766 CTGGGGAAGGGGGAGGGGCCAGG + Intergenic
1129170888 15:73807202-73807224 GTGAGGGAGGGGAAGGGGAGAGG + Intergenic
1129254846 15:74328416-74328438 CTCAGAAAGGTGAAGGGGCCTGG + Intronic
1129269462 15:74411738-74411760 CTGAGTGTGGGGTGGGGCCCGGG - Intronic
1129274193 15:74434479-74434501 GAGAGGGAGGGGAAGGAGCCAGG - Intergenic
1129690750 15:77712058-77712080 GTGGGTGAGGGGAAGTGGCCAGG - Intronic
1129699586 15:77759967-77759989 CGGAGGGAGGGGATGTGGCCCGG + Intronic
1129897822 15:79121752-79121774 GAGACTAAGGGGAAGGGGCCTGG - Intergenic
1130053687 15:80504813-80504835 CTCAGGGAGGGGAAGTGGCTGGG + Intronic
1130219975 15:82011250-82011272 TTCACTGAGGGGAAAGGGCCAGG - Intergenic
1131083281 15:89554643-89554665 CTGACTGCGAGGCAGGGGCCAGG - Intergenic
1131150486 15:90044423-90044445 CTGAGTGTGAGGAAGGGGGCCGG + Intronic
1131990498 15:98088644-98088666 CTGGGGGAGGGGAAGGGGCCGGG - Intergenic
1132099646 15:99014653-99014675 CTGGGGGAGGGGAAGGGGCCGGG + Intergenic
1132332832 15:101024619-101024641 CTGGGCGAGGGACAGGGGCCCGG - Intronic
1132354176 15:101159202-101159224 TTGAGACAGGGGAAGGGGCTGGG - Intergenic
1132663558 16:1071927-1071949 CAGAGTCAGGGGAGGGGGCTGGG + Intergenic
1132693825 16:1193350-1193372 CTGGGAGAGGCCAAGGGGCCTGG + Intronic
1132826563 16:1908214-1908236 CCGGTGGAGGGGAAGGGGCCTGG - Intergenic
1132885834 16:2181600-2181622 CTGAGTGGGGCGCAGGGGGCAGG + Intronic
1132906989 16:2287778-2287800 CTGAGTCAGGGGAAGTGCCCTGG - Intronic
1133101769 16:3484408-3484430 CGGGGGGTGGGGAAGGGGCCTGG - Intronic
1133921806 16:10160181-10160203 GTGAGTTAGGAGAAGGGGCTAGG - Intronic
1134062378 16:11206827-11206849 TTGAGTGAGGGCTAGGTGCCAGG - Intergenic
1134104493 16:11476165-11476187 GTGAGTGAGGGGCAGGGAACAGG + Intronic
1134606623 16:15576409-15576431 ATGAGAGAGGGGAACAGGCCTGG - Intronic
1134765694 16:16755727-16755749 CTCAGGGAGGGGAAGGGGAAGGG - Intergenic
1135033908 16:19060651-19060673 GTGAGTGATGGGAAGAGGCAAGG + Intronic
1136026305 16:27471150-27471172 CTGAGTGCGGGGAAGGAGAATGG + Intronic
1136040259 16:27572969-27572991 GTGAGTGAGGGGTAGGGGAGGGG - Intronic
1136070562 16:27784648-27784670 CTTAGGGAAGGCAAGGGGCCGGG - Intergenic
1136096748 16:27962442-27962464 CAGAGAGAGTGGCAGGGGCCAGG + Intronic
1136229172 16:28876973-28876995 GTCAGTGAGGGGAAGGGGCCTGG - Intergenic
1136406932 16:30053506-30053528 CCCAGAGAGGGGAAGGGGCCCGG - Intronic
1136474644 16:30505221-30505243 CTGAGCGAGGGGTAGTGGGCAGG - Intronic
1136500810 16:30668996-30669018 CTGAGGGTGGGGCAGGGGCAGGG - Intronic
1136514817 16:30761836-30761858 CGGAGCGAGGCGAACGGGCCCGG - Exonic
1136838060 16:33516565-33516587 GTGCGTGAGGGGCTGGGGCCCGG - Intergenic
1138404512 16:56778938-56778960 CTCAGTGAGGAGAAGAAGCCAGG + Intronic
1139582722 16:67882923-67882945 GTGAGTGAGGTGAAGTGGACAGG - Intronic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1139906081 16:70366886-70366908 CTGGCTGAGAGGGAGGGGCCAGG - Intronic
1140481132 16:75263501-75263523 CCCAGAGAGGGGAAGGAGCCAGG - Intronic
1140564715 16:76027653-76027675 CTGAGTGAGGAGATGAGTCCAGG + Intergenic
1140788216 16:78364034-78364056 CTGAGTGGGGGGATGTGGCACGG - Intronic
1141692967 16:85606897-85606919 CCGAGGCAGGGGAAGGGGGCTGG - Intergenic
1141802657 16:86321684-86321706 CTGCGTGTGGTGAAGGGGGCTGG - Intergenic
1141855676 16:86679809-86679831 GTGAATGGGGGGAAGGTGCCAGG - Intergenic
1141895174 16:86954437-86954459 GTGGGGGTGGGGAAGGGGCCTGG + Intergenic
1142150740 16:88511523-88511545 GTGAGTGAGGGTGAGGGGCCTGG - Intronic
1142222763 16:88863718-88863740 TTGAGAGAGGGGCTGGGGCCTGG - Exonic
1142532827 17:594474-594496 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532844 17:594546-594568 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532860 17:594619-594641 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532875 17:594690-594712 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532892 17:594762-594784 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532907 17:594835-594857 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532922 17:594906-594928 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532939 17:594979-595001 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532955 17:595050-595072 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532970 17:595121-595143 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532986 17:595192-595214 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533001 17:595265-595287 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533016 17:595336-595358 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533033 17:595408-595430 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533048 17:595481-595503 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533065 17:595552-595574 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533082 17:595624-595646 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533100 17:595696-595718 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533116 17:595767-595789 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533131 17:595838-595860 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533146 17:595909-595931 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533161 17:595980-596002 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1143332556 17:6148421-6148443 CTGAGTGCTGGGAAGCAGCCAGG - Intergenic
1144045793 17:11453364-11453386 TTGAGTGAGGGGAATAGGGCAGG - Intronic
1144452132 17:15389889-15389911 GTGAGTGAGGGGGAAGGTCCTGG - Intergenic
1144662446 17:17080039-17080061 CTGAGAGAGGGCATGGGGGCAGG + Intronic
1144718848 17:17453867-17453889 CGGAGTGAGGGGAGAGGCCCTGG - Intergenic
1144735710 17:17554227-17554249 GTGGCTGAGGGGAGGGGGCCGGG - Intronic
1144739375 17:17572672-17572694 CTGCGTGAGGGCCAGGGGCCGGG + Intronic
1145167238 17:20623858-20623880 CAGAGTGAGGAGTAGAGGCCAGG - Intergenic
1145823220 17:27856724-27856746 CAGAGAGTGGGGTAGGGGCCAGG - Intronic
1145925587 17:28644708-28644730 AGGAGTGTGAGGAAGGGGCCTGG - Intronic
1146134739 17:30309324-30309346 CTGAGTCAGGATGAGGGGCCAGG + Intergenic
1146648171 17:34589313-34589335 AGGAGGGAGGGGAAAGGGCCAGG + Intronic
1147262583 17:39217289-39217311 CTGTGTGAGGGGTAGGTGCTGGG - Intronic
1147446400 17:40477748-40477770 CTGAGTGAGGGGTGGGACCCAGG + Intronic
1147566837 17:41541637-41541659 CTGAGTGAGGGAGCGAGGCCCGG + Intergenic
1147573706 17:41586871-41586893 CTGAGTGAAGAGAAGGTGCTCGG + Exonic
1147725163 17:42562456-42562478 CCGGGGGAGGGGACGGGGCCTGG - Exonic
1148244478 17:46021448-46021470 CAGACTGTGGGGATGGGGCCAGG - Intronic
1148324167 17:46773631-46773653 CTGAGGGGGGGGGAGGGGCTGGG - Intronic
1148350847 17:46940962-46940984 CTCAGTGTAGGGAAGGGTCCAGG + Intronic
1148770666 17:50064201-50064223 AAAAGTGAGGGGAAGGGGCTGGG + Exonic
1150289132 17:63971665-63971687 GTGGGTGAGGGGAGGGGGCCAGG - Intronic
1150457336 17:65317372-65317394 ATGAGGAAGGGGAAGGGGCTTGG + Intergenic
1151658786 17:75508012-75508034 CTGAGTGAGGGGAGGGGCCCTGG - Intronic
1151807767 17:76417185-76417207 CTGAGTCAGGGAGAGGTGCCAGG - Intronic
1151923195 17:77173361-77173383 GTGAGTCGGGGGAAGGGTCCAGG + Intronic
1152240121 17:79156635-79156657 GTGAGTGAGGGGGTGTGGCCAGG - Intronic
1152259748 17:79260558-79260580 CAGAGTTAGGGGCACGGGCCTGG - Intronic
1152363650 17:79843546-79843568 CTGAGTGGGGGCCGGGGGCCGGG - Intergenic
1152626421 17:81389855-81389877 TTGAGAGTGGGGAGGGGGCCGGG + Intergenic
1152750455 17:82060164-82060186 CTGAGTCTGGGTGAGGGGCCAGG + Intronic
1152885216 17:82845462-82845484 CAGACGGAGAGGAAGGGGCCGGG - Intronic
1152885252 17:82845586-82845608 CGGAGGGAGAGCAAGGGGCCAGG - Intronic
1153540225 18:6146080-6146102 CTGGGTGAGGGGAAGGGTGGCGG + Intronic
1153592310 18:6686579-6686601 CAGAGTGACAGGAAGGAGCCAGG + Intergenic
1153778546 18:8475133-8475155 AGGAGAGAGGGGAAGGGGCAAGG - Intergenic
1153833681 18:8945255-8945277 CTGAGGGAGAGGAAGGGACCAGG + Intergenic
1153848367 18:9069991-9070013 CTGCGTGAGTGGGACGGGCCTGG - Intergenic
1153963079 18:10156460-10156482 CTGAGTGGAGGGAAGAAGCCAGG + Intergenic
1154075176 18:11193213-11193235 CAAAGTAAAGGGAAGGGGCCAGG - Intergenic
1155217579 18:23657028-23657050 CTGATGGAGGGGCAGTGGCCTGG - Intronic
1156036002 18:32769569-32769591 CGGAGGGAGGGGAGGGGGCAGGG - Intronic
1157623869 18:49032098-49032120 CTGAGCGGGGGAAAGGGGCTGGG + Intergenic
1158495904 18:57954931-57954953 CTGAGTTGGGGCAAGGGGACAGG + Intergenic
1158523698 18:58193875-58193897 CCGAGTGCAGGGAAGAGGCCAGG - Intronic
1160286364 18:77547232-77547254 CTGAGTGTGGGAAAGGAGCTTGG - Intergenic
1160357274 18:78239023-78239045 CTGCGTCAGGGGCAGGTGCCAGG - Intergenic
1160464725 18:79067123-79067145 TTGAGTGAGGGTAAGGAGACAGG + Intergenic
1160495973 18:79375635-79375657 CTGAGTGAGGGGAAGGGGCCGGG + Intronic
1160698995 19:497335-497357 CCGGGAGAGGGGAGGGGGCCCGG + Intronic
1160718455 19:587024-587046 CTCAGGGTGGGGAGGGGGCCAGG - Intergenic
1160814041 19:1027159-1027181 CTTTGGGAGGGGAAGGGGCATGG + Intronic
1160816004 19:1036107-1036129 CTGGGTGAGGGAAAGGGGCCGGG - Intronic
1160920736 19:1519065-1519087 CAGAAAGATGGGAAGGGGCCAGG + Intergenic
1160939784 19:1614855-1614877 CTGCCTGACGGGAAGGGGCCAGG + Intronic
1161103973 19:2434244-2434266 CAGAGTGAGGAGGAGGGGCAGGG - Intronic
1161160162 19:2757318-2757340 CTGCGTGAGTGCATGGGGCCGGG - Exonic
1161275280 19:3412855-3412877 CTGGCTGAGCGGGAGGGGCCGGG + Intronic
1161473800 19:4473676-4473698 CTGAGTGAGGGGCTGGGGGTGGG + Intronic
1161871908 19:6876816-6876838 CAGAGTGCCGGGAAGGGGCAGGG - Intergenic
1161958270 19:7508100-7508122 ATGAGTCAGGGGGCGGGGCCAGG - Intronic
1161983918 19:7643894-7643916 CTGAGTGAGGGGTGGGGCCTTGG + Intronic
1162018267 19:7857160-7857182 CAGGGTGCAGGGAAGGGGCCAGG - Intronic
1162028204 19:7905961-7905983 GAGAGTGAGGGGAAGGGACATGG - Intronic
1162137987 19:8567918-8567940 CCCAGTGAGGGGAAGTGGCCTGG - Intronic
1162386243 19:10362055-10362077 GTGGGTGCAGGGAAGGGGCCCGG - Intronic
1162430574 19:10625812-10625834 ATAAGTGGGGTGAAGGGGCCTGG - Intronic
1162490329 19:10987643-10987665 CTGGGAGAAGGCAAGGGGCCAGG - Intronic
1162676997 19:12306609-12306631 CTGAGTGAGGGGAAGCACCCAGG + Intergenic
1162953615 19:14086039-14086061 GGGAGTGAGGGGCTGGGGCCTGG - Intergenic
1163035005 19:14565002-14565024 CTGGGTGTGGGGACGGGGTCGGG + Intronic
1163115348 19:15185556-15185578 CAGAGTGGGGGCAAGGAGCCAGG + Exonic
1163732168 19:18955460-18955482 CTGGGTGAGAGGAAGGGACAGGG - Intergenic
1164512005 19:28905078-28905100 CTGAGTGAGGAGCAGGGAGCTGG - Intergenic
1164732574 19:30517410-30517432 GTGAGGGTGGGGAAGGGGCCCGG + Intronic
1165044509 19:33094046-33094068 GTGGGTGAGGGCAAGGGCCCAGG + Intronic
1165069550 19:33247708-33247730 TGGAGTGAAGGGAAGAGGCCGGG - Intergenic
1165101586 19:33441580-33441602 CTGAGTGAAGGGAAGGAACAGGG - Intronic
1165113571 19:33515565-33515587 CTGAGTGAAGGGAAAGGGCGTGG - Intronic
1165336769 19:35176003-35176025 CAGAGAGAGGGGGAGGTGCCAGG - Intergenic
1165350969 19:35275340-35275362 CAAAGTGAGTAGAAGGGGCCGGG - Intronic
1165495394 19:36149744-36149766 CTGGGTGAGGGCAAAGGGGCTGG + Intronic
1165823783 19:38693929-38693951 GTGAGTGCGGGGAAGGGGGGTGG - Intronic
1165996330 19:39846433-39846455 CTCCGGGCGGGGAAGGGGCCCGG - Intergenic
1166231680 19:41428385-41428407 CTGGGGGAGGGGAGGGGCCCGGG - Intronic
1166301181 19:41913008-41913030 CTGGGAGAGGGGAAGGCCCCGGG - Intronic
1166330698 19:42076464-42076486 CGGCGGGTGGGGAAGGGGCCTGG + Intronic
1166404349 19:42508938-42508960 CTGAGAGAGGGGCAGTGACCAGG + Exonic
1166774230 19:45302763-45302785 CTACAGGAGGGGAAGGGGCCAGG + Exonic
1166837830 19:45678011-45678033 GGGACCGAGGGGAAGGGGCCGGG + Intronic
1166892246 19:46000698-46000720 CTAGAGGAGGGGAAGGGGCCGGG + Intronic
1167078830 19:47265465-47265487 CTGTGTGAGGGGTGGGGACCTGG + Intronic
1167093360 19:47359779-47359801 CTGAGGGTGGGGGAGGGCCCAGG + Intronic
1167096896 19:47379497-47379519 CTGAGTCAGGGAAGGGGGCTGGG - Intronic
1167134712 19:47609622-47609644 CGGGGCGAGGGGAGGGGGCCGGG - Intronic
1167234012 19:48302945-48302967 CTGAGGGAGGGAAGGGGGCGGGG + Intronic
1167263796 19:48473379-48473401 GTGAGTGAGGGGGAGGGGTTTGG + Intronic
1167530760 19:50014780-50014802 CCAAGTGAGGTGAAGGGACCAGG - Intronic
1167631801 19:50630141-50630163 CTGGGTGAGGGGTCGGGGCAGGG + Exonic
1167729678 19:51244631-51244653 GAGAGTAAGGGGAAGGGGACAGG - Intergenic
1167735827 19:51294032-51294054 CTGTGTGGGGCGAGGGGGCCTGG - Intergenic
1167741039 19:51325238-51325260 CTGAGGGAGGAGGAGGGGCTGGG + Intronic
1167880606 19:52454111-52454133 TTGAGGGAGGTGACGGGGCCTGG + Intronic
1167972454 19:53197045-53197067 CTGGGGGCGGGGAAGGGGCGGGG - Intergenic
1168000792 19:53444540-53444562 CTCAGTGAGGGGAATGTGGCAGG - Intronic
1168253549 19:55154933-55154955 CTGAGGGAGGAGAAGGGGCTGGG + Intronic
1168253576 19:55155007-55155029 TTGAGGGAGGAGAAGGGGCTGGG + Intronic
1168273686 19:55264962-55264984 AGGTGTGAGGGGGAGGGGCCTGG - Intronic
1168325664 19:55537315-55537337 CTGAGGGAGGAGGAGGGGCTGGG - Intergenic
1168411233 19:56141497-56141519 CTGAGTGATGGGGAAGGGGCTGG + Intronic
1168652105 19:58097980-58098002 TGGAGTGCGGGGCAGGGGCCGGG - Intronic
1168652137 19:58098073-58098095 CAGCGTTAGGGAAAGGGGCCAGG - Intronic
925287878 2:2727606-2727628 CTGAGTGACAAGTAGGGGCCTGG - Intergenic
927153476 2:20208930-20208952 CTGTGGGTGGGGAAGGGGCAAGG - Intronic
927705348 2:25293283-25293305 CTGGGAGAGGGGAGGGGGCAGGG - Intronic
927706257 2:25298277-25298299 CCGAGTGAGGGGAGAGGGGCCGG - Intronic
927719169 2:25372184-25372206 CTGCGCGTGGGGCAGGGGCCGGG + Intergenic
927818917 2:26245075-26245097 CCCAGGGAGGGGAGGGGGCCGGG - Intronic
928394060 2:30930799-30930821 CTAGGTCAGTGGAAGGGGCCAGG - Intronic
928907237 2:36381107-36381129 CTGTGTGGGGGGTAGGGGCGGGG - Intronic
929596271 2:43178368-43178390 ATAAGTGAGAGGAAGGGGCCCGG + Intergenic
931614774 2:64144467-64144489 CTGAGGGAGGGGACCGGGCAGGG + Intergenic
932144552 2:69306583-69306605 CTGCGTGAGGGGGAGCGGCTGGG - Intergenic
932219223 2:69987147-69987169 CTGAGTGAGGGGAAGGCATTGGG + Intergenic
932301790 2:70672621-70672643 CTGAGTTGGGGCAAGGAGCCGGG + Intronic
932343646 2:70982130-70982152 CTGGGGGAGGGGAAGGGGGTGGG - Intronic
932396860 2:71454519-71454541 CTGAGAGAGAGCAAAGGGCCAGG - Intronic
932457519 2:71858769-71858791 CAGGGAGAGGGGAAGGGCCCAGG - Intergenic
932463996 2:71901785-71901807 CTGAATTGGGGGAAGGGCCCTGG - Intergenic
932475498 2:72003370-72003392 GTGTGTGAGGGGCAGAGGCCAGG + Intergenic
932569578 2:72931538-72931560 CAGGGTGGGGGGCAGGGGCCAGG + Intronic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
932731905 2:74227326-74227348 CTGGGTGAGGGGAGGAGCCCTGG + Intronic
932797354 2:74708335-74708357 CTGAGTGAGGGGAAAAGCCTAGG - Intergenic
933642834 2:84782574-84782596 GTGGGTGAGGGCAGGGGGCCAGG - Intronic
933694862 2:85210235-85210257 ATGTGTGTGGGGAAGGGGCCAGG - Intronic
933723703 2:85414068-85414090 GTGAGTCAGAGGGAGGGGCCCGG + Intronic
933934619 2:87192129-87192151 TTGAGCAAGTGGAAGGGGCCAGG - Intergenic
934758833 2:96842342-96842364 GTGAGAGAGGGGCGGGGGCCGGG - Intronic
935067581 2:99663791-99663813 CTTAGGGAGAGGAAGGGACCAGG - Intronic
935200896 2:100855751-100855773 GTGAGTTTGGGGAATGGGCCTGG - Intronic
935264776 2:101384889-101384911 AAGAGAGAGGGGAAGGTGCCAGG - Intronic
936053590 2:109243648-109243670 ATGAGTGGTGAGAAGGGGCCAGG + Intronic
936358524 2:111773767-111773789 TTGAGTAAGTGGAAGGGGCCAGG + Intronic
937301888 2:120847743-120847765 CTGCGTGGGGGGCAGGGGCGGGG + Intronic
937310140 2:120897031-120897053 CTGTGTGAGGGAGAGGGGCTGGG + Intronic
937925687 2:127165864-127165886 CTCAGTGAGTGGATGAGGCCTGG + Intergenic
938573785 2:132585549-132585571 CTGTGTGTGCGGACGGGGCCTGG + Intronic
938651901 2:133391619-133391641 ATGAGTGCGGGGAAGAGGGCTGG - Intronic
938776476 2:134545560-134545582 GTGAGTGCAGGGAAGGGGCCAGG - Intronic
940098996 2:150011920-150011942 CTGAGAGAGGGGAAGGCCTCTGG - Intergenic
942241094 2:173964654-173964676 GTGGGGGAGGGGAAGGGGCCTGG - Intronic
942945476 2:181667539-181667561 TTGAGGGAGGGGAAAGGGGCTGG + Intronic
945891515 2:215435933-215435955 CAGAGGGTGGGGAAGGGGACGGG + Exonic
946177080 2:217928584-217928606 CTGGGTTTGGGGAAAGGGCCAGG - Intronic
946904727 2:224405435-224405457 CTGAGTTAGACGAGGGGGCCAGG + Intergenic
947454511 2:230241593-230241615 CTGTGTGAGGGGAGGAGGACTGG - Intronic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
947792782 2:232877302-232877324 CGGAGTGAGGGTGAGGAGCCTGG + Intronic
948393330 2:237627556-237627578 CGGAGGGAGGGGCCGGGGCCGGG + Intronic
948462857 2:238138748-238138770 CTGAGTGAGAGGTAGGATCCAGG + Exonic
948593240 2:239064337-239064359 CTGGGGGCGGGGGAGGGGCCCGG + Intronic
948630768 2:239301159-239301181 CTGAGTAAGGGGGTGGTGCCCGG - Intronic
948632526 2:239311223-239311245 CTGAGAGCTCGGAAGGGGCCAGG - Intronic
948815396 2:240507739-240507761 CTGACAGAGGGGAAGGCCCCAGG + Intronic
949032247 2:241802637-241802659 CAGAGGGAGGAGGAGGGGCCGGG + Intronic
1168753721 20:301278-301300 GAGAGTGGGGGGATGGGGCCAGG - Intergenic
1168828275 20:828908-828930 CTGACTGAGGGGAAAGGGGTGGG - Intergenic
1168868139 20:1106326-1106348 CTGAGTGAGGGCATGGGTCAGGG + Intergenic
1169217464 20:3801868-3801890 TTGAGGGATGGGACGGGGCCTGG + Intronic
1170204541 20:13784520-13784542 CCGAGAGAGGGGAAGGCGACCGG + Intronic
1170370055 20:15638765-15638787 CTGACTGGGGCAAAGGGGCCAGG + Intronic
1171034188 20:21703224-21703246 CTGGCTGCGGGAAAGGGGCCAGG + Intergenic
1171337036 20:24394144-24394166 CTGAGAGAGGGACAGGGGTCGGG - Intergenic
1171460591 20:25295911-25295933 CTGAGTGACGGGCAGGGCCCTGG + Intronic
1172250514 20:33475993-33476015 CTGAGTGACAGGGAGGGACCTGG - Intergenic
1172328653 20:34058076-34058098 CTTTTTGAGGGGAAGGGGGCCGG + Intronic
1172488773 20:35317231-35317253 CTGTGTGTAGGAAAGGGGCCGGG - Intronic
1172625256 20:36343008-36343030 CTGAGTGAGGGGGAGGGGAGAGG + Intronic
1172785959 20:37469170-37469192 GTTAGTGAGTGGAAGGGGCCAGG - Intergenic
1172997606 20:39082812-39082834 GTGTGTGAGGGGATGTGGCCAGG + Intergenic
1173074994 20:39809699-39809721 CAGCGTGAGGGGATGGGGACAGG + Intergenic
1173095680 20:40025755-40025777 CTGAGGGAGGGGTAGAGCCCAGG + Intergenic
1173346393 20:42204674-42204696 CTGAGGGAGGGGTAGGTGGCAGG + Intronic
1173734080 20:45347529-45347551 TTGAGTGAGGTGAAGGGGGTAGG - Intronic
1173898868 20:46572241-46572263 GAGAGTGTGGGGCAGGGGCCAGG + Intronic
1173901473 20:46592790-46592812 CTGAGTGAGTGAAACAGGCCAGG + Intronic
1173941263 20:46913337-46913359 CTGAGTGAGAGGAGAGGGGCAGG + Intronic
1174762246 20:53217301-53217323 CTCAGGGAGCAGAAGGGGCCTGG + Intronic
1174890408 20:54385637-54385659 TTGAGTGAGAGGAAGAGGCTGGG - Intergenic
1175365130 20:58448333-58448355 CTGTCTGAGGAAAAGGGGCCAGG - Exonic
1175419541 20:58822734-58822756 CTGACTTCAGGGAAGGGGCCAGG - Intergenic
1175479220 20:59300021-59300043 CTGCGTGTGGGGCAGTGGCCTGG - Intergenic
1175632383 20:60552596-60552618 TTGAGTCAGAGGAAGGGGCTGGG + Intergenic
1175765149 20:61587256-61587278 CTGAGTGACTGGACAGGGCCGGG + Intronic
1175895350 20:62333528-62333550 CAGAGTGAGGGCTGGGGGCCGGG - Intronic
1176239153 20:64067911-64067933 CTGGGTGAGGGGCTGGGGGCGGG + Intronic
1176304698 21:5117293-5117315 GTGAGGGTGGGGGAGGGGCCGGG - Intronic
1176549060 21:8213699-8213721 CGGAGGGAGGGGCACGGGCCGGG - Intergenic
1176556954 21:8257919-8257941 CGGAGGGAGGGGCACGGGCCGGG - Intergenic
1176567992 21:8396737-8396759 CGGAGGGAGGGGCACGGGCCGGG - Intergenic
1176575896 21:8440956-8440978 CGGAGGGAGGGGCACGGGCCGGG - Intergenic
1178583420 21:33854457-33854479 GTGAGTGAGTGAAAGGGCCCGGG - Intronic
1178900056 21:36591513-36591535 AGAAGTGAGGGGTAGGGGCCGGG - Intergenic
1179000369 21:37452195-37452217 CTGAGGGAGGGCATGGAGCCTGG + Intronic
1179164500 21:38925077-38925099 CTCAGTGAGGAAAAGGAGCCAGG + Intergenic
1179542373 21:42091878-42091900 CTGAGAGAAGGGAAGAGGCCTGG + Intronic
1179785897 21:43729389-43729411 CTGAGAGAGGGGAGTTGGCCAGG + Intronic
1179852356 21:44144737-44144759 GTGAGGGTGGGGGAGGGGCCGGG + Intronic
1179886803 21:44317687-44317709 CTGGGTGCTGCGAAGGGGCCAGG + Intronic
1179891639 21:44338689-44338711 GTGAGGGAGGGGAGGAGGCCGGG - Intronic
1179911226 21:44449937-44449959 CTGAGTGAGGGGCAGGGGCTGGG + Intergenic
1180088207 21:45517613-45517635 CTGGGTGAGGATAAGAGGCCAGG - Intronic
1180130087 21:45821561-45821583 ATGAGTTAGGGGAGGGGGCGGGG - Intronic
1180394181 22:12314402-12314424 GTGGGTTAGGGGAAGGGGGCAGG - Intergenic
1180405565 22:12550347-12550369 GTGGGTTAGGGGAAGGGGGCAGG + Intergenic
1180619137 22:17148405-17148427 CTGGCTGAAGGGAAGGGGCAGGG - Intronic
1180965639 22:19786814-19786836 GTCAGGGAGGGGAAGGGTCCTGG - Exonic
1181019372 22:20090947-20090969 CTGAGGATGGGGAAGTGGCCCGG + Intronic
1181537286 22:23553042-23553064 CTGAGTGAGGGCTTGGGGCATGG - Intergenic
1182261078 22:29073332-29073354 AGGGGCGAGGGGAAGGGGCCCGG - Intronic
1182668302 22:31974825-31974847 CTGAATGATGAGAAGGAGCCAGG + Intergenic
1183503335 22:38194402-38194424 CAGAGGGAGGGGATGGGGACTGG + Intronic
1183535982 22:38401706-38401728 CTGTGGGACTGGAAGGGGCCTGG + Intergenic
1183666568 22:39249513-39249535 CTGAGAGAGGGCAAGGGACTAGG + Intergenic
1183984760 22:41563279-41563301 CTGGGGGAGGGGGAGGAGCCAGG + Intronic
1184114997 22:42417152-42417174 CTGTGTGAGGGTGAGGGGCGAGG - Intronic
1184155510 22:42664153-42664175 CTCAGTGACGGGAAAGGCCCAGG - Intergenic
1184254682 22:43280393-43280415 ATGGGTGAGGGGAAGGGACGGGG - Intronic
1184254703 22:43280443-43280465 ATGGGTGAGGGGAAGGGACAGGG - Intronic
1184254722 22:43280491-43280513 ATGGGTGAGGGGAAGGGACGGGG - Intronic
1184352576 22:43954378-43954400 GTGAGGGAAGGGCAGGGGCCTGG + Intronic
1184374377 22:44102540-44102562 CAGAGAGAGGTGAAGGGGCTGGG + Intronic
1184453848 22:44598154-44598176 CTCACTGAGGGGTAGGGGCTGGG - Intergenic
1184464227 22:44659533-44659555 CTGACTGTGGGGAAGAGGGCAGG - Intergenic
1184514134 22:44950927-44950949 CTGAGTGTGGGAAAGAGGCATGG + Intronic
1184744558 22:46448692-46448714 AGGAGTGAGTGGAAGGGCCCGGG + Intronic
1184925105 22:47631103-47631125 TTGAGAGAGGGGAAGGAGCTGGG + Intergenic
1185011115 22:48315274-48315296 CTGAGTGAGTGAAATGGGCAGGG - Intergenic
1185027626 22:48424753-48424775 CTCAGGGAGAGGCAGGGGCCAGG + Intergenic
1185281072 22:49970136-49970158 CTGAGGCAGGCGGAGGGGCCAGG + Intergenic
1185415949 22:50710340-50710362 GGGAGTGAGAGGAAGGGGCTGGG + Intergenic
1203253947 22_KI270733v1_random:130014-130036 CGGAGGGAGGGGCACGGGCCGGG - Intergenic
1203262003 22_KI270733v1_random:175093-175115 CGGAGGGAGGGGCACGGGCCGGG - Intergenic
949572185 3:5304093-5304115 CTGAAGGAGGGGATGGGGGCAGG + Intergenic
950032727 3:9862987-9863009 GGGAGCGAGGGGAAGGTGCCAGG - Intergenic
950161434 3:10764038-10764060 GTGAGTGAGGGGAAGGCAACAGG - Intergenic
950366400 3:12488149-12488171 CTGAGGGAGGGGAAGGTGAGTGG - Intronic
950467205 3:13162553-13162575 CAGAGGGAGGGCAAGGGGCAGGG - Intergenic
950530278 3:13549059-13549081 CGGAGTCAGGGGAGGGGGCCGGG + Intergenic
950970454 3:17181540-17181562 CTGAGTTAAGGGACAGGGCCTGG + Intronic
952835463 3:37598356-37598378 CTGGGGGAGGGGATGGTGCCAGG + Intronic
952890832 3:38039407-38039429 CTGCGTGAGGCGGCGGGGCCGGG - Exonic
953025013 3:39139751-39139773 CCCAGAGAGGGGAAGGGACCCGG - Intergenic
953418012 3:42734090-42734112 TTGAGGGAGGGGTGGGGGCCTGG - Intronic
953906735 3:46872180-46872202 CTCAGTGAGGGGCAGAGGGCTGG + Intronic
953916680 3:46925001-46925023 CTGAGGCAGGGGAGAGGGCCTGG - Intronic
953977822 3:47395593-47395615 CTGTGTGAGGAGAATGGCCCAGG - Intronic
953980115 3:47409394-47409416 CTGAGGAAGGGGTGGGGGCCAGG - Intronic
954142657 3:48617342-48617364 CCAAGTGAGGGGAAGTGGGCTGG - Intergenic
954448084 3:50557349-50557371 CTGAGCTAGAGGAAGGGGCTGGG - Intergenic
954595276 3:51819094-51819116 GTGGGTGAGAGGAAGTGGCCAGG - Intronic
954648226 3:52144259-52144281 CTGAGTGAAGGGCTGGGGCTTGG - Intronic
955239353 3:57165417-57165439 CTGAGGGTGGGGGCGGGGCCCGG - Intronic
955366863 3:58318228-58318250 CTTAGTTAGGGGAAGGGAGCAGG + Exonic
955422990 3:58758679-58758701 GTGGGTGAGGGGAAGGGGGAGGG - Intronic
955531750 3:59880301-59880323 CTGGATGAAGGGAAGGAGCCAGG - Intronic
956427937 3:69155803-69155825 GTGGGTGTGGGGAAGGGGTCAGG + Intergenic
957384115 3:79472943-79472965 CTAGGTGAGGGGAAGGTGCTAGG + Intronic
958265643 3:91434319-91434341 GTGACTGTGGGGAAGGGGGCAGG - Intergenic
959839707 3:110960140-110960162 CTTGGGGAGGGGAAGGGGGCTGG + Intergenic
960130468 3:114050643-114050665 CTGATGGAGGGGAAGGAGACTGG + Intronic
960855534 3:122098533-122098555 CAGTGTGAGGGGAAGGGATCTGG + Intronic
960896863 3:122514712-122514734 CGGCGGGAGGGGGAGGGGCCGGG + Intronic
961332934 3:126153662-126153684 CTGGGAGAGGGAGAGGGGCCAGG + Intronic
961378690 3:126483259-126483281 CTGGGTGTGGGGATGGGGGCCGG - Intronic
961475239 3:127141855-127141877 CTGTGTTAGGGGAGGAGGCCTGG - Intergenic
961499778 3:127324029-127324051 CATATTGAGGGGAAGGGGCTGGG - Intergenic
961549703 3:127662006-127662028 TTGAGTGAGAGGAGGAGGCCAGG - Intronic
961698883 3:128726389-128726411 CTGAGGGGGGGGATGGGGCCAGG - Intronic
961798279 3:129425397-129425419 ATGAGTGAGGGGGCGGGGGCTGG - Intronic
961820293 3:129572460-129572482 CTCAGAGAGGAGAAGGGGCTTGG + Intronic
961828007 3:129608551-129608573 GTGAGTGAGGAGGAGGGGCATGG - Intergenic
962268543 3:133961047-133961069 GTGCATGATGGGAAGGGGCCTGG + Intronic
962747843 3:138410771-138410793 CTGAGGGAGGGGAGGCAGCCGGG + Intergenic
963062993 3:141240419-141240441 CTGAGTGAGGCAAAGGAGCATGG - Intronic
964612877 3:158632439-158632461 TTGAGTGAGGGGCAGGGGGAGGG + Intergenic
965202505 3:165677472-165677494 GGGAGGGAGGGGAAGGGGCCTGG - Intergenic
965300301 3:166999209-166999231 CTAAGGGAGGAGAGGGGGCCTGG + Intergenic
965486302 3:169282659-169282681 CTTAATGAGGGCAAAGGGCCTGG - Intronic
967198028 3:187046249-187046271 TTGAGTGAGAGGCAGGAGCCAGG + Intronic
967452633 3:189644232-189644254 ATGAGAGAGGGGAAGGGACTTGG - Intronic
967452643 3:189644269-189644291 ATGAGAGAGGGGAAGGGACTTGG - Intronic
967858297 3:194134392-194134414 CGTAGTGAGGGGGAGCGGCCCGG + Intergenic
968434365 4:576875-576897 GGGAGGGAGGGGGAGGGGCCGGG + Intergenic
968434392 4:576924-576946 GGGAGGGAGGGGGAGGGGCCGGG + Intergenic
968434420 4:576974-576996 GGGAGGGAGGGGGAGGGGCCGGG + Intergenic
968443498 4:636390-636412 CTGAGAGAGGGTACGGGGGCAGG + Intronic
968529807 4:1085626-1085648 CTGAGGCAGTGGGAGGGGCCTGG - Intronic
968573683 4:1355223-1355245 CTGAGGGAGGGGAAAGGCGCAGG + Exonic
968598878 4:1499787-1499809 CTGACTGTGGAGCAGGGGCCTGG - Intergenic
968760820 4:2442135-2442157 CTGAGTGTGGGGATGGGGTTTGG + Intronic
968972611 4:3803803-3803825 CTGAGCGAAGGGAGGGGTCCTGG - Intergenic
969281660 4:6174852-6174874 CAGAGGGTGAGGAAGGGGCCAGG - Intronic
969379035 4:6782544-6782566 CGGAGGGAGGGGCAGGGGCGGGG + Intronic
969416174 4:7060950-7060972 CCGGTTGAGGGGAAGGAGCCAGG - Exonic
969520367 4:7674663-7674685 GGCAGTGAGGGGAAGGGGCCGGG + Intronic
969590591 4:8119843-8119865 CTGAGTGAGCCTAAGGGGTCAGG + Intronic
969596271 4:8150999-8151021 CTGAGTGAGAGTCAAGGGCCTGG - Intronic
970602935 4:17654607-17654629 ATGAGTGAGTGGAAAGGGCTTGG - Intronic
970762503 4:19507875-19507897 CTGAGTGAGGGAAAGCTGCCTGG - Intergenic
972330688 4:38062071-38062093 GTGAGTGTGGGGATGGGGTCTGG + Intronic
972629190 4:40828873-40828895 CTGAGGGAGGGACAGGGGCAGGG - Intronic
975584936 4:75940332-75940354 GGGAGTGGGGGGAAGGGGGCGGG + Intronic
979238095 4:118424201-118424223 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
979899457 4:126200027-126200049 CTGAGAGATGGCTAGGGGCCAGG - Intergenic
980420692 4:132556322-132556344 CTGTGTGAGGGGAAAGTGCCAGG + Intergenic
981681996 4:147409862-147409884 TAGAGTGAGAGGAAGGGGCATGG - Intergenic
984002839 4:174271557-174271579 CTGAGTGAGGGAAAGGGGTTGGG - Intronic
984478234 4:180264903-180264925 GGGAGTGAGGGGAAGGGGCATGG - Intergenic
985233605 4:187848950-187848972 CTCAGAGAGGGGCAGGGGTCAGG - Intergenic
985493191 5:191048-191070 CCGAGTGAGGCGCAGGGGCCTGG + Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
986623904 5:9705930-9705952 CTTGGTGAGAGGAAGGGACCTGG + Intronic
988798324 5:34673306-34673328 CTGTGTGAGGGCAATGGGGCAGG + Intronic
989631124 5:43483775-43483797 GGGACTGAGGGGAGGGGGCCGGG - Intronic
990513870 5:56514508-56514530 CAGAGACAGGGGAAGGTGCCAGG - Intronic
991193278 5:63901356-63901378 CTGAGGGAAGGGAAGGGTCATGG - Intergenic
992416626 5:76558292-76558314 ATGTGTGAGGGGTAGGGGCTGGG - Intronic
992499488 5:77327860-77327882 CTGTGTGGGGGGAAGGCTCCCGG - Intronic
993499756 5:88651989-88652011 CTGAGCAAAGGGAAGGGGTCAGG - Intergenic
997561059 5:134846329-134846351 CGGAGTGAGAGGAGGGGCCCCGG + Intronic
997599469 5:135129594-135129616 CTGAGCGACAGGAAGGGGCAAGG + Intronic
997613639 5:135231890-135231912 CCGAGGGTGGGGAAGGGCCCTGG - Intronic
997663208 5:135605373-135605395 CTGAGTGTGAGGATGTGGCCAGG + Intergenic
997727118 5:136131334-136131356 CAGAGTGAGAGGAAGGGAGCGGG + Intergenic
999082158 5:148854963-148854985 TAGAGTGTGAGGAAGGGGCCTGG + Intergenic
999125245 5:149241463-149241485 CTGAAAGATGAGAAGGGGCCTGG + Intronic
999267401 5:150275909-150275931 CTCAGGGAGGGGAGGGGGGCTGG - Intronic
999277346 5:150340013-150340035 CTGATTGAGGGGGTGGGGCATGG - Intergenic
999375983 5:151086884-151086906 CTGGGTGAGGAGCAGGGGCTGGG + Intronic
999500088 5:152138198-152138220 CTGATGGAGTGGAAGGGGCAGGG - Intergenic
1001110690 5:168893712-168893734 GTGAGTGAGGGGGAGGTGGCAGG + Intronic
1001401256 5:171447862-171447884 GTGAGGGAGGGGCAGGGGCTAGG + Intronic
1001411507 5:171515609-171515631 CCGAGAGAGGGGAAGGGGCCAGG + Intergenic
1001568059 5:172713262-172713284 CCCAGCAAGGGGAAGGGGCCGGG + Intergenic
1001865942 5:175105484-175105506 CACAGAGAGGGGAAGTGGCCTGG - Intergenic
1001896858 5:175389878-175389900 CTGAGTGAGGGGAAAAGCCATGG + Intergenic
1001951169 5:175817657-175817679 GGGATTGAGGGGAAGGTGCCTGG + Intronic
1002106222 5:176880603-176880625 CTGGGGGAGGGGCAGGGGCAGGG - Exonic
1002599869 5:180347979-180348001 CTGAGTGAGGGGACCGTTCCAGG + Intronic
1002738522 5:181416177-181416199 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1002789132 6:424849-424871 CTGGGACAGAGGAAGGGGCCAGG + Intergenic
1002866030 6:1123345-1123367 CTAACCAAGGGGAAGGGGCCAGG - Intergenic
1003551753 6:7107478-7107500 CTGCCCGAGGGGAAGGGTCCGGG - Intergenic
1003925879 6:10877121-10877143 CAGAGTGAGGACATGGGGCCAGG - Exonic
1004017056 6:11741785-11741807 GAGAGAGAGGGGAAGGGGGCAGG - Intronic
1004169244 6:13283278-13283300 GTGAGTGAGGGGCAGGGGCAGGG - Intronic
1004934323 6:20492352-20492374 GTGTGTGAGGGGAGGAGGCCAGG - Exonic
1005215370 6:23521285-23521307 CTGAGAGAGGTGAAGGGGCAGGG - Intergenic
1005417704 6:25619333-25619355 TTGGGGGAGGGGAGGGGGCCAGG - Intronic
1005851885 6:29828521-29828543 CTGACCGAGGGGGTGGGGCCAGG + Exonic
1006030179 6:31172117-31172139 CTGTGTGAGGGGATTGGGACTGG - Intronic
1006053223 6:31359472-31359494 TTGAGTGAAGGGAAGGGGTGAGG - Intergenic
1006084550 6:31586861-31586883 ATGATGGAGGGGAAGGAGCCTGG - Intronic
1006173748 6:32109708-32109730 GGGAGGGAGGGGAAGGGGGCTGG - Intronic
1006307826 6:33235261-33235283 CTGAGTGAGGTGGAGGGGTCTGG + Intergenic
1006322890 6:33330865-33330887 CTGAGGGAGGGGAGGGGGAACGG + Intergenic
1006376394 6:33673861-33673883 CTCAGTGAGGGGGAAGGGCAGGG + Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006878779 6:37321234-37321256 CTGAGTGAGTGATAGAGGCCTGG + Intronic
1007093639 6:39200076-39200098 CTGGGTTAGGGGAAGGGACATGG + Intronic
1007304147 6:40891289-40891311 CTCAGTGGGAGGAAGTGGCCAGG - Intergenic
1007359363 6:41344030-41344052 CAGTGTGAGGTGAAGGGGCTTGG - Intronic
1007364900 6:41384478-41384500 GTGAGTGAGGGAAGGGGGCTTGG - Intergenic
1007720567 6:43882796-43882818 CTGAGTGAGGAGAGGGTGGCAGG - Intergenic
1007809551 6:44476286-44476308 CGGAGTGAGGAGAGGCGGCCAGG - Intergenic
1008421747 6:51309016-51309038 CAGAGTGAGGGGCATGGGCCAGG - Intergenic
1008989724 6:57588335-57588357 GTGACTGTGGGGAAGGGGGCAGG + Intronic
1009178307 6:60486879-60486901 GTGACTGTGGGGAAGGGGGCAGG + Intergenic
1011763969 6:90599023-90599045 CTGAGTGAGGGGCTGGAGACTGG + Intergenic
1012924308 6:105252170-105252192 TTGAGTTAGGGGAAGGGGTAGGG + Intergenic
1012972416 6:105745648-105745670 CTGAGAGGTGGGCAGGGGCCAGG + Intergenic
1013196635 6:107849981-107850003 GTGGGTGAGGGGAATGGTCCTGG - Intergenic
1013263662 6:108472212-108472234 TTGAGTGAGGAGAAGGGGAAGGG + Intronic
1013273673 6:108562887-108562909 CTGTCTTGGGGGAAGGGGCCAGG - Intronic
1014639764 6:123894749-123894771 GTGAATGCGGGGAAGGGGCAGGG + Intronic
1015830790 6:137366367-137366389 CTGGGTGAGCGGAAGTGCCCTGG + Intergenic
1016561142 6:145396277-145396299 ATGAGGGAGAGGAAGGAGCCCGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017131309 6:151110550-151110572 CTGGCTGAGAGGAAGGGGCTTGG + Intergenic
1017769771 6:157636017-157636039 CTGAGTGTGGAGGAGGTGCCGGG - Intronic
1019167484 6:170108375-170108397 CCACGTGAGGGGAAGGGTCCTGG - Intergenic
1019167503 6:170108448-170108470 CCATGTGAGGGGAAGGGTCCTGG - Intergenic
1019243625 6:170691729-170691751 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1019395612 7:816423-816445 GGGAGGGAGGGGGAGGGGCCTGG - Intergenic
1019441796 7:1051159-1051181 CTGAGTGACAGGAAGGGGCCTGG - Intronic
1019547819 7:1586956-1586978 CTGAGGGAGGGGACGGGTCCTGG - Intergenic
1019870292 7:3754668-3754690 CTAAGTAAGGGGAAGGGGGGTGG + Intronic
1020137938 7:5596905-5596927 CTCATTTAGGGGAGGGGGCCTGG - Intronic
1020154710 7:5713229-5713251 CTGAGTGGTGGGGAGGGGCAGGG + Intronic
1020274905 7:6617918-6617940 CTGAGTGAGGGCCTGGGGCAGGG + Intronic
1021057464 7:16067664-16067686 GGGAGGGTGGGGAAGGGGCCAGG + Intergenic
1021315648 7:19144777-19144799 CTGGGTGAGGCTAAAGGGCCGGG - Exonic
1022098038 7:27152953-27152975 CTGGATGCGGGGAAGGGGCGAGG - Intergenic
1022109434 7:27219504-27219526 CTGAGTTGGGGGAAGGGGGGAGG + Intergenic
1022332025 7:29388978-29389000 GTGACTGAAGGGAAGGGACCAGG - Intronic
1023215838 7:37861648-37861670 ATGAGTGAGTGAAAGGGGCATGG + Intronic
1023745560 7:43319488-43319510 CTGAGGGAGGAGACGAGGCCTGG - Intronic
1023915043 7:44582356-44582378 CTGTGTGAGGGGGCGGGGCGCGG - Intergenic
1023920926 7:44629323-44629345 CTGAGGGAGTGGAAGGAGCTGGG + Intronic
1024201984 7:47117267-47117289 CTGGGAGAGAGGAAGGGCCCAGG - Intergenic
1024553342 7:50581973-50581995 CTGAGAGAGGGGAAGGGTAGTGG - Intergenic
1024666360 7:51550955-51550977 CAGAGTGAGAGGAAGGGGAGAGG + Intergenic
1024895700 7:54259371-54259393 CTGAATGGGGTGAAGGGGCCAGG + Intergenic
1026593644 7:71716342-71716364 TGGTGTGAGGGGAAGGGGCTGGG - Intergenic
1027219511 7:76204956-76204978 CTGAGTGAGGAGAAAGGAGCTGG - Intronic
1028086526 7:86644132-86644154 CGGAGTGGGGTGAAGGGGCATGG - Exonic
1029284137 7:99454535-99454557 CTGGGGGAGGGGATGGGGACAGG - Intronic
1029691048 7:102182039-102182061 ATGAAAGAGGGGAAGGGGACAGG - Intronic
1030109405 7:106013671-106013693 CTGGGTGAGGGGAAGGGTAGCGG - Intronic
1031522862 7:122787698-122787720 CTGAGTGTGGGGCAGGGACAAGG + Intronic
1032391261 7:131556682-131556704 CTGGGGGAGGGGGAGGGGCGGGG - Intronic
1033308085 7:140239438-140239460 CTGAGTGGAGGCAAGGGGCTGGG - Intergenic
1034455558 7:151168005-151168027 CTGGGTGGAGGGAAGGGGACCGG - Intronic
1034622031 7:152463902-152463924 GTGAGTTAGGGGCAGGGGCGGGG + Intergenic
1034936219 7:155202657-155202679 CTGAGAGAGGGGAAGCATCCCGG - Intergenic
1035504497 8:116431-116453 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
1035601320 8:898543-898565 CTGTGTGCAGGGAAGGGGCCTGG + Intergenic
1035676950 8:1462693-1462715 CTGGGGAAGGGGAAGGGACCAGG + Intergenic
1035686081 8:1524326-1524348 CTGACTGGGAGGAAGGAGCCTGG + Intronic
1036168463 8:6459831-6459853 CTGAGTAATGTGAAGGTGCCAGG + Intronic
1036496762 8:9277171-9277193 CTGCCAGAGGGGAAGGAGCCTGG - Intergenic
1036699238 8:11000976-11000998 CTGAATCAGAGGAAGGGGGCAGG - Intronic
1036729911 8:11253606-11253628 CAGAGTGACTGCAAGGGGCCTGG - Intergenic
1037443192 8:18938324-18938346 AAGAATGAGGGAAAGGGGCCAGG + Intronic
1037827651 8:22168750-22168772 GTGACTCAGGGGCAGGGGCCTGG - Intronic
1038179218 8:25210868-25210890 CTGAATGAGGGGAGGGGGAAGGG + Intronic
1038241213 8:25809265-25809287 CACAGTGAGGGGAAGGGGTTGGG + Intergenic
1038612528 8:29069374-29069396 CAGAGTGTGGGGCTGGGGCCTGG - Exonic
1038655614 8:29448671-29448693 ATAAGTGAGGGGAAAAGGCCAGG - Intergenic
1038699377 8:29835595-29835617 CAGAGTGAGGTGATGGGCCCTGG - Intergenic
1038742332 8:30226485-30226507 AGAAGTGAGGGGAAGAGGCCAGG - Intergenic
1039442806 8:37607076-37607098 CAGAGTGAAAGGGAGGGGCCAGG + Intergenic
1039490006 8:37940303-37940325 TTGAGTGAGGGAAACGGGCTTGG - Intergenic
1039898567 8:41734140-41734162 CTCAGGGCTGGGAAGGGGCCTGG - Intronic
1039901151 8:41753421-41753443 CTGACTGAGGGGAAGGGGTCTGG - Intronic
1040577642 8:48667685-48667707 ATTAGTAAGGGGAAGGGGGCTGG - Intergenic
1041368103 8:57130661-57130683 CTGAGGGAGGGGAAGGAGCAGGG - Intergenic
1042325437 8:67522873-67522895 CTGAGTGGGTGGAGTGGGCCTGG + Intronic
1042561280 8:70073496-70073518 CTAGTTGAGGGGAAGGGGCCGGG - Intergenic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1044519111 8:93177244-93177266 GTGAGTGGGGGGAAGGGGTGAGG + Intergenic
1045412432 8:101932190-101932212 CTGTGGCAGGGGAGGGGGCCTGG - Intronic
1046130103 8:109956117-109956139 CTGAGTGGGGGGAGGGGGGAGGG - Intergenic
1046644957 8:116776082-116776104 CAGGGTATGGGGAAGGGGCCAGG - Intronic
1047980964 8:130181659-130181681 CTGTGTGTGGGGAGGGGGCCAGG + Intronic
1048430805 8:134368766-134368788 CTGAGAGAGTAGAAAGGGCCTGG - Intergenic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1048474054 8:134727259-134727281 CTGAGTGATAAGAAGGAGCCAGG + Intergenic
1048976228 8:139674498-139674520 CTCTGTGAGGGGCAGGGACCCGG + Intronic
1049270625 8:141693736-141693758 CTGAGGGAGAGGGAGGGGCACGG + Intergenic
1049273155 8:141706841-141706863 CTGAGTGAGGAGGAAGGGCTGGG + Intergenic
1049406897 8:142455636-142455658 CTGAGTGAGGAGTGGGGGACAGG - Intronic
1049521806 8:143095229-143095251 CTGGGGGAGGGGACGGGGGCTGG - Intergenic
1049686541 8:143941442-143941464 CTCAGGGAAGGGAAGGGGCACGG + Intronic
1052055650 9:23904400-23904422 GTGACTGAGGGAAAGGAGCCAGG - Intergenic
1052859538 9:33428483-33428505 CTAAGTGGGGTGAAGGGGCCAGG + Intergenic
1052914691 9:33915912-33915934 CTGAGTGACAGGAAGGAGCCAGG + Intronic
1053348546 9:37395994-37396016 GTGTGGGAGGGGAGGGGGCCGGG - Intergenic
1055712409 9:79077484-79077506 CTGAGTGACAGGAAGGGGCCAGG - Intergenic
1056110231 9:83388027-83388049 CTGAGTGAGACGAAGGTGGCAGG - Intronic
1056657599 9:88522120-88522142 CTGAGTGCCGGGAAGGAGCAGGG + Intergenic
1056803837 9:89712910-89712932 CAGGGTGAGGGGCAGGGGCAGGG + Intergenic
1057082219 9:92181441-92181463 CTCTGTGAGGAGAAGGGGCCAGG + Intergenic
1057147042 9:92765195-92765217 CTGAGTGTGGGGAAGGCCGCGGG - Intergenic
1057180028 9:93024764-93024786 CTGAGTGTGGGACAGGGTCCTGG + Intronic
1057311081 9:93943697-93943719 CTGAGGCAGGGGCAGGGGCAGGG - Intergenic
1057796359 9:98160789-98160811 CTGCCTGACTGGAAGGGGCCTGG - Intronic
1059119665 9:111630937-111630959 GTTAGTGAGAGGAAGGCGCCCGG + Intergenic
1059357137 9:113708703-113708725 CAGAGTGAGGGAAAGGTGCTGGG + Intergenic
1059432800 9:114260115-114260137 CTGAGGCAGGGCAGGGGGCCTGG - Intronic
1060183860 9:121552099-121552121 CTGGGTGCTGGGGAGGGGCCTGG - Intergenic
1060401388 9:123351503-123351525 GTGAGTTAGTGGATGGGGCCTGG + Intergenic
1060480071 9:124012495-124012517 CTGAGAGCTGGGATGGGGCCGGG + Intronic
1060891674 9:127193168-127193190 CTGAGAGAAGAGAAGGGCCCCGG + Intronic
1061216430 9:129224532-129224554 CTGAGTGAGGAGAAGGTACTAGG + Intergenic
1061379114 9:130243693-130243715 CTGAGGCAGGGGCAGGGGTCTGG + Intergenic
1061464527 9:130767044-130767066 CTGAGTGAAGGGCAGGGCCCAGG - Intronic
1061678300 9:132230521-132230543 CTGCCCCAGGGGAAGGGGCCTGG - Intronic
1061848194 9:133399982-133400004 CTGGGTGAGGGGCAGTGGCCAGG - Intronic
1061987990 9:134141332-134141354 GGGAGGGAGGGGAAGGGGACTGG + Intronic
1062195160 9:135268997-135269019 CTTAGTGAGGGGCAGGGAGCTGG - Intergenic
1062252226 9:135604088-135604110 CTGAGTGCGTGGAAGGGCCCTGG + Intergenic
1062291504 9:135797316-135797338 CTGAGTGAGGGCAGGGGCCCAGG - Intergenic
1062461567 9:136664612-136664634 CTGGGGGCTGGGAAGGGGCCCGG - Intronic
1062479489 9:136744778-136744800 CTGAGAGCTGGGGAGGGGCCGGG + Intronic
1062708729 9:137960190-137960212 CTGAGTGAGGGGGAGGGGGAGGG + Intronic
1203470347 Un_GL000220v1:113158-113180 CGGAGGGAGGGGCACGGGCCGGG - Intergenic
1203478168 Un_GL000220v1:157130-157152 CGGAGGGAGGGGCACGGGCCGGG - Intergenic
1203603814 Un_KI270748v1:40952-40974 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1185925659 X:4142837-4142859 CTGACAGTGGGGAAGTGGCCAGG - Intergenic
1186193550 X:7089329-7089351 GAGAGTGAGGTGAAGGGACCTGG + Intronic
1187363221 X:18646755-18646777 GTGAGGGAGGGGAAGAGGCGTGG - Intronic
1188520612 X:31033807-31033829 CTGACTGAGAGGAAGTGGCAAGG - Intergenic
1189246333 X:39566295-39566317 CTGAGAGAGGGCCTGGGGCCTGG - Intergenic
1189298630 X:39936354-39936376 GTGAGGGAGGGGAAAGGGGCAGG + Intergenic
1189333136 X:40155054-40155076 CTGCGGGAGGGGAGGGGGTCGGG + Intronic
1189564133 X:42222256-42222278 GTGAGTAGGGGGAAGGGGACAGG - Intergenic
1190327626 X:49216363-49216385 CTGCGTGAGGGACAGGGCCCTGG - Exonic
1191085491 X:56563552-56563574 CTGGGGGAGGGGAAGGGGCGGGG + Intergenic
1192913001 X:75624879-75624901 TTTAGTGAGGGTAAGGTGCCAGG + Intergenic
1195641513 X:107180714-107180736 CTGAGTATGGGAAAGGGGCAGGG + Intronic
1195696878 X:107674007-107674029 CAGAGGAAGGGGAAGGGGCGGGG + Intergenic
1195721857 X:107875791-107875813 CTAAGAGAAGAGAAGGGGCCCGG + Intronic
1195767479 X:108311652-108311674 CTGAGTGATGAAAAGAGGCCAGG - Intronic
1197733394 X:129831272-129831294 CTTAGTGATGGGCAGTGGCCAGG - Intronic
1198122580 X:133608415-133608437 CTGACAGAGGGCAAGGGTCCTGG + Intronic
1199766787 X:150947158-150947180 CTGAGTGGGAGGTAGGGGGCAGG + Intergenic
1199860234 X:151794847-151794869 ATGAGTGAGGGAAAGGAGCTGGG - Intergenic
1201565465 Y:15360850-15360872 AAGAGTGAGGTGAAGGGACCTGG + Intergenic
1202385875 Y:24325997-24326019 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1202484911 Y:25344131-25344153 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic