ID: 1160498238

View in Genome Browser
Species Human (GRCh38)
Location 18:79387696-79387718
Sequence CAATGAGAGGCACCTGCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160498238_1160498248 30 Left 1160498238 18:79387696-79387718 CCATTAGCAGGTGCCTCTCATTG No data
Right 1160498248 18:79387749-79387771 TTGGCTCCCGTAGGTGTACCGGG No data
1160498238_1160498241 -2 Left 1160498238 18:79387696-79387718 CCATTAGCAGGTGCCTCTCATTG No data
Right 1160498241 18:79387717-79387739 TGATCTACCCTGAGAGGTGAAGG No data
1160498238_1160498244 11 Left 1160498238 18:79387696-79387718 CCATTAGCAGGTGCCTCTCATTG No data
Right 1160498244 18:79387730-79387752 GAGGTGAAGGCCGTTACTATTGG No data
1160498238_1160498247 29 Left 1160498238 18:79387696-79387718 CCATTAGCAGGTGCCTCTCATTG No data
Right 1160498247 18:79387748-79387770 ATTGGCTCCCGTAGGTGTACCGG No data
1160498238_1160498240 -8 Left 1160498238 18:79387696-79387718 CCATTAGCAGGTGCCTCTCATTG No data
Right 1160498240 18:79387711-79387733 TCTCATTGATCTACCCTGAGAGG No data
1160498238_1160498246 21 Left 1160498238 18:79387696-79387718 CCATTAGCAGGTGCCTCTCATTG No data
Right 1160498246 18:79387740-79387762 CCGTTACTATTGGCTCCCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160498238 Original CRISPR CAATGAGAGGCACCTGCTAA TGG (reversed) Intergenic