ID: 1160498239

View in Genome Browser
Species Human (GRCh38)
Location 18:79387709-79387731
Sequence TCTCAGGGTAGATCAATGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160498239_1160498251 23 Left 1160498239 18:79387709-79387731 CCTCTCATTGATCTACCCTGAGA No data
Right 1160498251 18:79387755-79387777 CCCGTAGGTGTACCGGGGACTGG No data
1160498239_1160498247 16 Left 1160498239 18:79387709-79387731 CCTCTCATTGATCTACCCTGAGA No data
Right 1160498247 18:79387748-79387770 ATTGGCTCCCGTAGGTGTACCGG No data
1160498239_1160498244 -2 Left 1160498239 18:79387709-79387731 CCTCTCATTGATCTACCCTGAGA No data
Right 1160498244 18:79387730-79387752 GAGGTGAAGGCCGTTACTATTGG No data
1160498239_1160498246 8 Left 1160498239 18:79387709-79387731 CCTCTCATTGATCTACCCTGAGA No data
Right 1160498246 18:79387740-79387762 CCGTTACTATTGGCTCCCGTAGG No data
1160498239_1160498248 17 Left 1160498239 18:79387709-79387731 CCTCTCATTGATCTACCCTGAGA No data
Right 1160498248 18:79387749-79387771 TTGGCTCCCGTAGGTGTACCGGG No data
1160498239_1160498249 18 Left 1160498239 18:79387709-79387731 CCTCTCATTGATCTACCCTGAGA No data
Right 1160498249 18:79387750-79387772 TGGCTCCCGTAGGTGTACCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160498239 Original CRISPR TCTCAGGGTAGATCAATGAG AGG (reversed) Intergenic