ID: 1160498240

View in Genome Browser
Species Human (GRCh38)
Location 18:79387711-79387733
Sequence TCTCATTGATCTACCCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160498238_1160498240 -8 Left 1160498238 18:79387696-79387718 CCATTAGCAGGTGCCTCTCATTG No data
Right 1160498240 18:79387711-79387733 TCTCATTGATCTACCCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160498240 Original CRISPR TCTCATTGATCTACCCTGAG AGG Intergenic
No off target data available for this crispr