ID: 1160498243

View in Genome Browser
Species Human (GRCh38)
Location 18:79387725-79387747
Sequence AGTAACGGCCTTCACCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160498243_1160498255 21 Left 1160498243 18:79387725-79387747 CCTGAGAGGTGAAGGCCGTTACT No data
Right 1160498255 18:79387769-79387791 GGGGACTGGAATCCAAACTCGGG No data
1160498243_1160498248 1 Left 1160498243 18:79387725-79387747 CCTGAGAGGTGAAGGCCGTTACT No data
Right 1160498248 18:79387749-79387771 TTGGCTCCCGTAGGTGTACCGGG No data
1160498243_1160498249 2 Left 1160498243 18:79387725-79387747 CCTGAGAGGTGAAGGCCGTTACT No data
Right 1160498249 18:79387750-79387772 TGGCTCCCGTAGGTGTACCGGGG No data
1160498243_1160498246 -8 Left 1160498243 18:79387725-79387747 CCTGAGAGGTGAAGGCCGTTACT No data
Right 1160498246 18:79387740-79387762 CCGTTACTATTGGCTCCCGTAGG No data
1160498243_1160498254 20 Left 1160498243 18:79387725-79387747 CCTGAGAGGTGAAGGCCGTTACT No data
Right 1160498254 18:79387768-79387790 CGGGGACTGGAATCCAAACTCGG No data
1160498243_1160498251 7 Left 1160498243 18:79387725-79387747 CCTGAGAGGTGAAGGCCGTTACT No data
Right 1160498251 18:79387755-79387777 CCCGTAGGTGTACCGGGGACTGG No data
1160498243_1160498257 28 Left 1160498243 18:79387725-79387747 CCTGAGAGGTGAAGGCCGTTACT No data
Right 1160498257 18:79387776-79387798 GGAATCCAAACTCGGGCTGTGGG No data
1160498243_1160498256 27 Left 1160498243 18:79387725-79387747 CCTGAGAGGTGAAGGCCGTTACT No data
Right 1160498256 18:79387775-79387797 TGGAATCCAAACTCGGGCTGTGG No data
1160498243_1160498247 0 Left 1160498243 18:79387725-79387747 CCTGAGAGGTGAAGGCCGTTACT No data
Right 1160498247 18:79387748-79387770 ATTGGCTCCCGTAGGTGTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160498243 Original CRISPR AGTAACGGCCTTCACCTCTC AGG (reversed) Intergenic
No off target data available for this crispr