ID: 1160498244 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:79387730-79387752 |
| Sequence | GAGGTGAAGGCCGTTACTAT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1160498238_1160498244 | 11 | Left | 1160498238 | 18:79387696-79387718 | CCATTAGCAGGTGCCTCTCATTG | No data | ||
| Right | 1160498244 | 18:79387730-79387752 | GAGGTGAAGGCCGTTACTATTGG | No data | ||||
| 1160498239_1160498244 | -2 | Left | 1160498239 | 18:79387709-79387731 | CCTCTCATTGATCTACCCTGAGA | No data | ||
| Right | 1160498244 | 18:79387730-79387752 | GAGGTGAAGGCCGTTACTATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1160498244 | Original CRISPR | GAGGTGAAGGCCGTTACTAT TGG | Intergenic | ||