ID: 1160498244

View in Genome Browser
Species Human (GRCh38)
Location 18:79387730-79387752
Sequence GAGGTGAAGGCCGTTACTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160498238_1160498244 11 Left 1160498238 18:79387696-79387718 CCATTAGCAGGTGCCTCTCATTG No data
Right 1160498244 18:79387730-79387752 GAGGTGAAGGCCGTTACTATTGG No data
1160498239_1160498244 -2 Left 1160498239 18:79387709-79387731 CCTCTCATTGATCTACCCTGAGA No data
Right 1160498244 18:79387730-79387752 GAGGTGAAGGCCGTTACTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160498244 Original CRISPR GAGGTGAAGGCCGTTACTAT TGG Intergenic
No off target data available for this crispr