ID: 1160498248

View in Genome Browser
Species Human (GRCh38)
Location 18:79387749-79387771
Sequence TTGGCTCCCGTAGGTGTACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160498238_1160498248 30 Left 1160498238 18:79387696-79387718 CCATTAGCAGGTGCCTCTCATTG No data
Right 1160498248 18:79387749-79387771 TTGGCTCCCGTAGGTGTACCGGG No data
1160498243_1160498248 1 Left 1160498243 18:79387725-79387747 CCTGAGAGGTGAAGGCCGTTACT No data
Right 1160498248 18:79387749-79387771 TTGGCTCCCGTAGGTGTACCGGG No data
1160498242_1160498248 2 Left 1160498242 18:79387724-79387746 CCCTGAGAGGTGAAGGCCGTTAC No data
Right 1160498248 18:79387749-79387771 TTGGCTCCCGTAGGTGTACCGGG No data
1160498239_1160498248 17 Left 1160498239 18:79387709-79387731 CCTCTCATTGATCTACCCTGAGA No data
Right 1160498248 18:79387749-79387771 TTGGCTCCCGTAGGTGTACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160498248 Original CRISPR TTGGCTCCCGTAGGTGTACC GGG Intergenic
No off target data available for this crispr