ID: 1160499130

View in Genome Browser
Species Human (GRCh38)
Location 18:79393918-79393940
Sequence TGCCGTTGCCGGGACCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160499130_1160499145 23 Left 1160499130 18:79393918-79393940 CCACCGTGGTCCCGGCAACGGCA No data
Right 1160499145 18:79393964-79393986 GGATTCCGTCACCCGGGCGGGGG No data
1160499130_1160499143 21 Left 1160499130 18:79393918-79393940 CCACCGTGGTCCCGGCAACGGCA No data
Right 1160499143 18:79393962-79393984 CGGGATTCCGTCACCCGGGCGGG No data
1160499130_1160499138 16 Left 1160499130 18:79393918-79393940 CCACCGTGGTCCCGGCAACGGCA No data
Right 1160499138 18:79393957-79393979 AGACCCGGGATTCCGTCACCCGG No data
1160499130_1160499144 22 Left 1160499130 18:79393918-79393940 CCACCGTGGTCCCGGCAACGGCA No data
Right 1160499144 18:79393963-79393985 GGGATTCCGTCACCCGGGCGGGG No data
1160499130_1160499148 30 Left 1160499130 18:79393918-79393940 CCACCGTGGTCCCGGCAACGGCA No data
Right 1160499148 18:79393971-79393993 GTCACCCGGGCGGGGGGATAAGG No data
1160499130_1160499146 24 Left 1160499130 18:79393918-79393940 CCACCGTGGTCCCGGCAACGGCA No data
Right 1160499146 18:79393965-79393987 GATTCCGTCACCCGGGCGGGGGG No data
1160499130_1160499136 1 Left 1160499130 18:79393918-79393940 CCACCGTGGTCCCGGCAACGGCA No data
Right 1160499136 18:79393942-79393964 TAAACAGAGGGAAACAGACCCGG No data
1160499130_1160499142 20 Left 1160499130 18:79393918-79393940 CCACCGTGGTCCCGGCAACGGCA No data
Right 1160499142 18:79393961-79393983 CCGGGATTCCGTCACCCGGGCGG No data
1160499130_1160499137 2 Left 1160499130 18:79393918-79393940 CCACCGTGGTCCCGGCAACGGCA No data
Right 1160499137 18:79393943-79393965 AAACAGAGGGAAACAGACCCGGG No data
1160499130_1160499139 17 Left 1160499130 18:79393918-79393940 CCACCGTGGTCCCGGCAACGGCA No data
Right 1160499139 18:79393958-79393980 GACCCGGGATTCCGTCACCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160499130 Original CRISPR TGCCGTTGCCGGGACCACGG TGG (reversed) Intergenic