ID: 1160499146

View in Genome Browser
Species Human (GRCh38)
Location 18:79393965-79393987
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160499132_1160499146 14 Left 1160499132 18:79393928-79393950 CCCGGCAACGGCATTAAACAGAG No data
Right 1160499146 18:79393965-79393987 GATTCCGTCACCCGGGCGGGGGG No data
1160499130_1160499146 24 Left 1160499130 18:79393918-79393940 CCACCGTGGTCCCGGCAACGGCA No data
Right 1160499146 18:79393965-79393987 GATTCCGTCACCCGGGCGGGGGG No data
1160499131_1160499146 21 Left 1160499131 18:79393921-79393943 CCGTGGTCCCGGCAACGGCATTA No data
Right 1160499146 18:79393965-79393987 GATTCCGTCACCCGGGCGGGGGG No data
1160499133_1160499146 13 Left 1160499133 18:79393929-79393951 CCGGCAACGGCATTAAACAGAGG No data
Right 1160499146 18:79393965-79393987 GATTCCGTCACCCGGGCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160499146 Original CRISPR GATTCCGTCACCCGGGCGGG GGG Intergenic