ID: 1160502940

View in Genome Browser
Species Human (GRCh38)
Location 18:79411234-79411256
Sequence CAGGTCCAGGCTGCTGTCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 274}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160502940_1160502949 17 Left 1160502940 18:79411234-79411256 CCACCGACAGCAGCCTGGACCTG 0: 1
1: 0
2: 0
3: 26
4: 274
Right 1160502949 18:79411274-79411296 CAAGTCCCGCAAGACCACCCTGG 0: 1
1: 0
2: 1
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160502940 Original CRISPR CAGGTCCAGGCTGCTGTCGG TGG (reversed) Exonic
900981268 1:6047585-6047607 CAGTGCCAGGCAGCTGTTGGTGG - Intronic
900981619 1:6049160-6049182 CAGTGCCAGGCAGCTGTTGGTGG - Intronic
901642847 1:10701781-10701803 TAGGACCAGGCAGCTGACGGGGG + Intronic
901822348 1:11838221-11838243 CAGCTCCAGGCTGCTGAGGCAGG - Intronic
901854066 1:12032885-12032907 GAGGTCGAGGCTGCAGTGGGCGG - Intergenic
902184122 1:14712302-14712324 CTGGTCCAGGGTGCTGGCAGTGG + Intronic
902331066 1:15731470-15731492 CAGGTCCAGTCTGATGGGGGAGG + Intronic
902374930 1:16026216-16026238 CAGGAACAGGGTGCTGCCGGTGG - Exonic
902865325 1:19274053-19274075 CATGTCCCGGCAGCTGTCGCGGG - Intergenic
902867442 1:19288688-19288710 CATGTCCCGGCAGCTGTCGCGGG - Exonic
905390721 1:37634143-37634165 CAGGCCCAGGCTGCGGACTGGGG + Intronic
907255667 1:53176953-53176975 GAGCTCCATGCTGCTGTCAGTGG - Intergenic
911192250 1:94959893-94959915 GAGGTCCAGGCTGCAGTGAGTGG - Intergenic
914429832 1:147611334-147611356 CTGGTCCATGCTGCTTGCGGGGG + Intronic
915596717 1:156900445-156900467 CAAATCCAGGCTGCTGGCAGAGG - Intronic
917811668 1:178664415-178664437 CCGGTCCAGGCAGCTGTTGTGGG - Intergenic
917966514 1:180182479-180182501 CAGGCCCAGGCTCCTGACGGTGG - Intronic
918146328 1:181759063-181759085 CAGGACCAGGCTGATGGCTGTGG - Intronic
922683062 1:227616936-227616958 CAGGTCCAGGCTGCTGTACAAGG + Intronic
924333971 1:242968260-242968282 CAGCTTCTGGCTGCTGTCTGAGG + Intergenic
924540127 1:244972432-244972454 GATGTCCAGGCTGCTGTCCACGG - Intronic
1063461943 10:6220597-6220619 CAGGTGCATCCTGCTGTGGGTGG + Intronic
1065797202 10:29318668-29318690 CCGGGCCAGGCTGCTGTCATCGG + Intergenic
1067055086 10:43045446-43045468 CAGGCCCTGGATGCTGCCGGGGG - Intergenic
1069897318 10:71687717-71687739 CAGGTACAGGCTCAGGTCGGGGG + Intronic
1070171952 10:73939740-73939762 TAGGTCCAGGCTGCAGTGAGTGG - Intergenic
1070537851 10:77392829-77392851 CAGGGACAGGCTGGTTTCGGAGG - Intronic
1070784289 10:79154183-79154205 CAGGTCCATTCTGGTGTTGGAGG - Intronic
1070882241 10:79860595-79860617 CAGTTCCAGGCTGCTCCCTGTGG + Intergenic
1072107954 10:92291527-92291549 CAGGTACGGGCAGCTGTGGGGGG + Exonic
1072208105 10:93222113-93222135 CACGCCCTGGCTGCTGTGGGAGG - Intergenic
1072434321 10:95401548-95401570 CAGGTGCAGACTGCTGGCTGGGG + Intronic
1072624393 10:97101691-97101713 CCAGTCCAGGCTGCTGTCTGAGG - Intronic
1075650557 10:124125915-124125937 CTGGTTCATGCTGCTGTTGGTGG + Intergenic
1075787793 10:125061692-125061714 CAGGTCCAGGATGCTGCACGGGG - Intronic
1076441632 10:130484655-130484677 CTGGCCCAGGCTGCTGAGGGAGG + Intergenic
1077100512 11:820294-820316 CAGTTGCAGGCTGCTATCAGGGG + Intronic
1077353874 11:2105744-2105766 CAGGTCCTGGCTGCTGGCTGTGG - Intergenic
1078077929 11:8178453-8178475 CAGCTCCATGCTGCTTTGGGGGG + Intergenic
1081033889 11:38117608-38117630 CAGGTGCATGGTGCTGTCAGTGG - Intergenic
1081747907 11:45485904-45485926 CAGGCCCAGGCTGCTGGAGGTGG - Intergenic
1081868952 11:46374672-46374694 CGGGGCCAGGCTGCCGTGGGTGG + Intronic
1082080137 11:48006402-48006424 CAGGTGCAGGCAGGTGTGGGAGG + Intronic
1083755957 11:64791878-64791900 AAGGGCCAGGCTGCTGGGGGTGG - Intronic
1085019102 11:73193933-73193955 CAGGTCCAGGCCACGGCCGGAGG - Intergenic
1085444810 11:76593217-76593239 CAGATCCAAGCTGCTGAGGGCGG - Intergenic
1090672665 11:128960025-128960047 CAGGTCCAGGCAACTGTCCTGGG - Intergenic
1091060510 11:132457046-132457068 CAGAACCAGACTGCTGTGGGTGG + Intronic
1091132370 11:133157323-133157345 CAGGTCCAGGCAGCTGCAGTCGG + Intronic
1091479370 12:810880-810902 CAGTTCCAGGCTGCTGGGGGTGG - Intronic
1091816947 12:3446003-3446025 CTGATCCAGGATGCTGTAGGAGG - Intronic
1091894630 12:4091253-4091275 CAGGTCCTGCCTGCTGAGGGAGG + Intergenic
1092256779 12:6930298-6930320 CAGGTCCAGAATGATGTTGGGGG + Intronic
1096760202 12:53835532-53835554 CAGGTCAAGGCTGCAGTGAGTGG - Intergenic
1096995375 12:55834906-55834928 CAGGTCCAGGACGGTGTGGGGGG - Intergenic
1097029076 12:56079165-56079187 CAGGTCCGGGCAGCTGGTGGGGG + Intergenic
1097086019 12:56469066-56469088 GAGTGCCAGGCTGCTGTGGGCGG - Exonic
1103053418 12:117800329-117800351 CAGGGCCAGGTTCCTGTCTGTGG + Intronic
1103881144 12:124166891-124166913 GAGGTCCAGGCTGCTGTCCAGGG - Intronic
1104842415 12:131831428-131831450 CATGTCCTGGCTTCTGCCGGTGG + Intronic
1104870027 12:131988404-131988426 CAGGTTCAGGCTGGTGGCTGGGG + Intronic
1105299117 13:19117359-19117381 CAGGTTAGGGGTGCTGTCGGGGG - Intergenic
1105805619 13:23950299-23950321 CAGGCCCAGGCTGCCGCCTGGGG - Intergenic
1106087679 13:26557880-26557902 CCGGGCCGGGCGGCTGTCGGGGG + Intronic
1106404789 13:29464075-29464097 GAGGTCCTGGCTGCTGGCTGTGG + Intronic
1108275686 13:48807403-48807425 CAGGTGCAGGCTTCAGTGGGGGG - Intergenic
1111912548 13:94328602-94328624 CAGGGCCATGCTGCTGGCTGTGG - Intronic
1113799462 13:113078773-113078795 GTGGTTCAGGCTGCGGTCGGAGG - Intronic
1113807835 13:113120310-113120332 CAGGCCCTGGCTGCAGTGGGAGG + Exonic
1115296128 14:31829118-31829140 AAGGTCCAGGATGCTGTCATGGG + Intronic
1118723385 14:68609576-68609598 CCGGTCCAGGCTGAGGACGGCGG - Intronic
1121016021 14:90549566-90549588 CAGGCCCTGGCTGCTGCTGGTGG + Intronic
1121590952 14:95108682-95108704 CAGGACAGGGCTGCTGACGGTGG + Intronic
1121690076 14:95871893-95871915 CAGGACCAGGCTGGGGGCGGTGG + Intergenic
1122352331 14:101103364-101103386 CAGGCCCAGGCTGCTGGTGCAGG + Intergenic
1202939751 14_KI270725v1_random:136116-136138 AGGGTCCAGGGTCCTGTCGGGGG - Intergenic
1123505974 15:20941577-20941599 CAGGTTAGGGGTGCTGTCGGAGG + Intergenic
1123563206 15:21515284-21515306 CAGGTTAGGGGTGCTGTCGGAGG + Intergenic
1123599455 15:21952567-21952589 CAGGTTAGGGGTGCTGTCGGAGG + Intergenic
1125575718 15:40754526-40754548 GAGGTCTGGGCTGCTTTCGGTGG - Intronic
1126108621 15:45162882-45162904 CAGGTCCAGGCTGGTGTGAAAGG - Intronic
1126675394 15:51156034-51156056 CAGGACCAGGCAGCTGTTGGAGG + Intergenic
1127430946 15:58907548-58907570 GAGGTCAAGGCTGCAGTCAGGGG + Intronic
1127598472 15:60511377-60511399 CAGGTAGAAGCTGCTGACGGCGG + Exonic
1127877295 15:63122191-63122213 CAGGTCGCGGCTGCTCTCGATGG - Exonic
1127931842 15:63601993-63602015 CAGGACCAGGCGGCTGCCGGGGG - Exonic
1128249807 15:66156191-66156213 CACTTCCAGGCTGCTGTGAGAGG - Intronic
1129111869 15:73341889-73341911 GAGGCCCAGGCTGCTGCTGGGGG + Intronic
1130260550 15:82350797-82350819 CAGGTCCAGGGTGGGGCCGGAGG - Intergenic
1130280682 15:82518207-82518229 CAGGTCCAGGGTGGGGCCGGAGG + Intergenic
1130472054 15:84234390-84234412 CAGGTCCAGGGTGGGGCCGGAGG + Intergenic
1130479548 15:84348961-84348983 CAGGTCCAGGGTGGGGCCGGAGG + Intergenic
1130492222 15:84439168-84439190 CAGGTCCAGGGTGGGGCCGGAGG - Intergenic
1202971558 15_KI270727v1_random:242418-242440 CAGGTTAGGGGTGCTGTCGGAGG + Intergenic
1132568845 16:635376-635398 CAGGGCCTGGCTTCTGTTGGGGG - Intronic
1132871568 16:2117810-2117832 CAGGGCCACGATGCTGTAGGCGG + Exonic
1133234402 16:4381176-4381198 CAGGTCCAGGTTGCTGAGGTTGG - Exonic
1134520961 16:14919085-14919107 CAGGGCCACGATGCTGTAGGCGG - Intronic
1134566781 16:15258428-15258450 TACATCCAGGCTGCTGTCTGTGG + Intergenic
1134708637 16:16317736-16317758 CAGGGCCACGATGCTGTAGGCGG - Intergenic
1134715850 16:16357769-16357791 CAGGGCCACGATGCTGTAGGCGG - Intergenic
1134735712 16:16498271-16498293 TACATCCAGGCTGCTGTCTGTGG - Intergenic
1134931814 16:18213951-18213973 TACATCCAGGCTGCTGTCTGTGG + Intergenic
1134950967 16:18350909-18350931 CAGGGCCACGATGCTGTAGGCGG + Intergenic
1134958906 16:18394390-18394412 CAGGGCCACGATGCTGTAGGCGG + Intergenic
1135424235 16:22324436-22324458 GAGGCCCAGGCTGCTGCTGGAGG + Intronic
1136070657 16:27785073-27785095 CTGGGCCAGGCTCCTGTCTGGGG - Intergenic
1137576931 16:49606261-49606283 CAGGCCCCTTCTGCTGTCGGTGG - Intronic
1139334413 16:66221198-66221220 CAGGTGCAGGCTGAGGTGGGAGG - Intergenic
1139459262 16:67109263-67109285 TTGGTCCACGCTGCTGCCGGCGG + Intergenic
1140053278 16:71501972-71501994 CAGGTCAAGGCTGCAGTGAGCGG - Intronic
1140304905 16:73794069-73794091 GAGGACCAGCCTGCTGTCAGAGG - Intergenic
1141082507 16:81064806-81064828 CTGTTCCAGGCTGCTGTCTTTGG - Intronic
1141103533 16:81215104-81215126 CAGGTCCAGGATGCCGTCTACGG - Intergenic
1141663863 16:85455779-85455801 CACGTGCAGGCAGCTGTCTGGGG + Intergenic
1142412820 16:89924836-89924858 CAGGCCAAGGCAGCTGTCAGAGG - Intronic
1143732698 17:8890003-8890025 CAGGACCAAGCTGCAGGCGGTGG - Exonic
1144671651 17:17136209-17136231 CAGGCCCAGGCTCCTGGAGGAGG - Exonic
1145254550 17:21315489-21315511 CAGGTCCAGTCTGCTGGTGGCGG + Intergenic
1145322047 17:21772476-21772498 CAGATCCAGTCTGCTGGTGGCGG - Intergenic
1145919334 17:28598845-28598867 CTGGGCCGGGCTGCTGTCGCGGG - Intronic
1147677728 17:42219323-42219345 CACGTCCAGGCTGCCCTCGGGGG + Exonic
1147688308 17:42300248-42300270 CACGTCCAGGCTGCCCTCGGGGG - Exonic
1148129691 17:45255408-45255430 CAGGTCCATCCTGCTGGAGGAGG + Exonic
1148354182 17:46964416-46964438 CAGGTCCCGGCTGCTCTTAGAGG - Intronic
1148438408 17:47699310-47699332 CCCGGCCAGCCTGCTGTCGGTGG - Exonic
1151403644 17:73872768-73872790 CAGCTCCAGGCTTCTATCAGTGG - Intergenic
1151800992 17:76379708-76379730 CACCTCCAGGCTGCTGACTGTGG - Intronic
1152639835 17:81444837-81444859 CTGGTCCAGGCTGCTGTACTTGG + Intronic
1152783241 17:82235665-82235687 CAGGTCGATGTTCCTGTCGGGGG + Exonic
1152866005 17:82723424-82723446 CTGGTCCTGCCTGCTGGCGGGGG + Intronic
1152935034 17:83131741-83131763 CAAGTCCAGACAGCTGGCGGGGG - Intergenic
1153608637 18:6859369-6859391 CAGCTCCAGGCTGTCGTCTGTGG + Intronic
1153945487 18:10013837-10013859 TGGGTCCAGGCTGCTGTCATTGG - Intergenic
1155070785 18:22314122-22314144 GAGGCCCGGGCTGCTGTCTGTGG + Intergenic
1156764470 18:40634999-40635021 CAGGTTGAGGCTGCTGGCTGGGG + Intergenic
1159085368 18:63783709-63783731 CAGGTCCAGGCTGCATGCAGAGG + Intronic
1160085282 18:75771713-75771735 GAGGTCGAGGCTGCTGTGAGTGG - Intergenic
1160277156 18:77447814-77447836 CAGGTCCAGGCAGCTGAGGGAGG + Intergenic
1160502940 18:79411234-79411256 CAGGTCCAGGCTGCTGTCGGTGG - Exonic
1161395872 19:4044565-4044587 GAGGTCCAGGCTGGGGTTGGGGG - Exonic
1161441915 19:4296714-4296736 TAGGACCAGCCTGCTGGCGGGGG - Intronic
1163273205 19:16266583-16266605 CAGGACCCGGCTGCGGTCAGGGG - Intergenic
1163424573 19:17234458-17234480 CAGATCCAGGCTACTCTGGGAGG - Intronic
1163665112 19:18599628-18599650 TGGGTCCAGGCAGCGGTCGGGGG - Exonic
1163824492 19:19515453-19515475 CAGGAGGCGGCTGCTGTCGGGGG + Exonic
1165081550 19:33309946-33309968 CAGGTCCAGGCAGCTGGCCCTGG + Intergenic
1167149842 19:47702243-47702265 CAGGTTCAGGATGCTGTCGATGG - Exonic
1167883479 19:52481799-52481821 CAGGTCAAGGCTGCAGTTAGAGG - Intronic
1168337339 19:55604067-55604089 CAGGTCGAGGCTGCAGTGAGCGG - Intergenic
926050931 2:9744337-9744359 CTGGGGCAGGCTGCTGTAGGAGG + Intergenic
926168385 2:10535736-10535758 CAGGTCCAGGCAGTGCTCGGTGG + Intergenic
926309164 2:11662097-11662119 CAGCTCCAGGCGGCTGGGGGTGG + Exonic
927346680 2:22052154-22052176 CAGCTCCACTCTGTTGTCGGTGG + Intergenic
927930303 2:27039587-27039609 CAGCTCCAGGCTGCTGTGGAGGG - Intronic
931247448 2:60503367-60503389 CCTGTCCAGGCTGCGGTGGGTGG - Intronic
932661934 2:73662570-73662592 CAGGTCCAGGAGGCTTTTGGTGG + Intergenic
933891796 2:86778703-86778725 GATGTCCAGGCTGCTGGAGGGGG + Intergenic
934654495 2:96110155-96110177 CAGATCCTGGTTGCTGTGGGTGG - Intergenic
937880378 2:126859912-126859934 CAGCTCCAGGCTGCTTGCTGTGG - Intergenic
939171733 2:138703952-138703974 CATGTCCAGGCTGGTGGCGCAGG - Intronic
939861100 2:147421431-147421453 AAGTTCCAGGCTGCTGGCAGTGG + Intergenic
943701644 2:190994278-190994300 TAGGTCCAGGCTGCAGAAGGGGG + Intronic
946333722 2:219024210-219024232 CAGGAGCAGGCTGCGGTAGGTGG + Exonic
948023996 2:234762103-234762125 CAGCTCCTGGGTGCTGTCAGTGG + Intergenic
948662429 2:239515597-239515619 CAGGTCTGGGCTACTGTCAGTGG - Intergenic
948699822 2:239752573-239752595 CAGGGCCAGTGTGCTCTCGGGGG - Intergenic
948735099 2:239998479-239998501 CAGGCCTATGCTGCTGTCTGTGG + Intronic
948808603 2:240463524-240463546 CAGTTCCAGGCCGCTCTCGCGGG - Intronic
1169748396 20:8966064-8966086 TAGGTCTAGGCTGCAGTCAGAGG - Intronic
1173853067 20:46231125-46231147 CAGGAGCGGGCTGCTGTCCGTGG + Intronic
1175182522 20:57158671-57158693 CAGGTCAAGGTTACAGTCGGGGG - Intergenic
1175226503 20:57447608-57447630 GAGGTCCAGGCTGCAGTGAGAGG - Intergenic
1176008034 20:62876777-62876799 GAGGCCGAGGCAGCTGTCGGGGG - Intergenic
1177456221 21:21343521-21343543 CATGTCAAGGCTGCTGAGGGTGG - Intronic
1178922582 21:36748104-36748126 CGGGTCCAGGCTCCTGGCGCGGG - Exonic
1180834134 22:18921411-18921433 CAGGTCCATGGTGCTGAGGGAGG + Exonic
1180857693 22:19058770-19058792 CCGGTCCAGGCAGCTTTCGTGGG - Intronic
1180907801 22:19427373-19427395 AAGGTCCAGCCTGCTGCCGGAGG - Intronic
1180925292 22:19549562-19549584 CAGGTCCAGGCTCCACTAGGTGG + Intergenic
1181115990 22:20632837-20632859 CAGCTCCTGGCTGCTGTGGGTGG - Intergenic
1181433297 22:22895711-22895733 CAGCTCCAGGCTCCCGTGGGTGG - Exonic
1181436820 22:22915949-22915971 CAGCTCCAGGCCCCTGTGGGTGG - Intergenic
1181437661 22:22919875-22919897 CAGCTCCAGGCCCCTGTGGGTGG - Intergenic
1181438309 22:22922930-22922952 CAGCTCCAGGCCCCTGTGGGTGG - Intergenic
1181550886 22:23638586-23638608 CAGCTCCAGGCCCCTGTGGGTGG + Intergenic
1181797400 22:25320103-25320125 CAGCTCCAGGCCCCTGTGGGTGG - Intergenic
1181985735 22:26798932-26798954 CAGGTCCAGGCTGCCACAGGAGG - Intergenic
1183092431 22:35531943-35531965 CAGGTGCAGGCTGCTGATGATGG - Intergenic
1183364101 22:37398165-37398187 CAGAGCCAGGCAGCTGTGGGCGG + Intronic
1203284222 22_KI270734v1_random:146709-146731 CAGGTCCATGGTGCTGAGGGAGG + Intergenic
949525017 3:4894893-4894915 CAGGTCCTGACTGCAGTCGAGGG - Intergenic
952931693 3:38365671-38365693 CAGCTGGAGGCTGCTGTGGGTGG + Exonic
953420391 3:42749492-42749514 CATGTCAAGGGTGCTGTCTGGGG + Intronic
953697992 3:45174689-45174711 CAGGTCCAGGCTGCAGTACAAGG - Intergenic
953843451 3:46408018-46408040 CAGGATAAGGCAGCTGTCGGAGG + Intronic
953917396 3:46929372-46929394 CAGGTCCAGGCTGCTATCCTAGG + Intronic
954336181 3:49919110-49919132 GAGGTCCAGGCTGCAGTGAGTGG + Intronic
954456910 3:50604626-50604648 CAGGGCCCGGCTCCTGTCTGGGG - Intergenic
955202388 3:56862595-56862617 CAGGACGAGGCTGCTGCAGGCGG + Intronic
959653909 3:108779294-108779316 CAGGTCCAGGCAGCTGACTGAGG + Intergenic
961314682 3:126026460-126026482 CAGGTGCAGGCCACTGTCGTGGG - Exonic
965828107 3:172751015-172751037 CAGGGCCCGGCTGCTGGGGGTGG - Intronic
968094120 3:195916006-195916028 CAGTTCGAGGCTGCAGTGGGGGG + Intergenic
968601665 4:1512740-1512762 CAGGTCCGGGCCGATGTCCGTGG + Intergenic
968673296 4:1863860-1863882 CAGGACCAGGCTTCAGTCGTGGG - Intergenic
968890222 4:3364850-3364872 CAGGGCCTGGCTGCTGCAGGAGG + Intronic
970741595 4:19246174-19246196 CAGGACCAGGCTGGGCTCGGTGG + Intergenic
971308775 4:25506264-25506286 CAGGTCCAGGATGATGGGGGCGG - Intergenic
974916245 4:68182356-68182378 GTGGACCAGGCTGCTGACGGCGG - Intergenic
977265634 4:94850059-94850081 CATGTCCATGGTGCTGTGGGAGG - Intronic
979243136 4:118467054-118467076 CAGCTTCTGGCTGCTGTCTGAGG - Intergenic
983649760 4:170026415-170026437 CCGGCCCAGGCTCCTGTAGGTGG - Intronic
983940140 4:173529104-173529126 CAGGGCCATGCTGTAGTCGGGGG + Exonic
985267085 4:188160384-188160406 CAGGGTCCGGCTGCTTTCGGAGG + Intergenic
986852832 5:11832868-11832890 AAGGTCAAGGCTGCTGTGAGCGG + Intronic
988842293 5:35094896-35094918 GAGGTCCAGGCTGCAGTGAGCGG - Intronic
989676973 5:43983681-43983703 CAGATCCAGGCTGCTGTGCAAGG - Intergenic
991626736 5:68610743-68610765 TAGGTACAGGCTGCAGTGGGTGG - Intergenic
995955385 5:117770277-117770299 AAGGTCCAGGCTGGTATTGGGGG - Intergenic
997459823 5:134044338-134044360 CAGGTGTTGGCTGCTGTTGGAGG - Intergenic
997479762 5:134176523-134176545 AAGGCCCAGGCTGCGGCCGGGGG - Intronic
999440348 5:151595782-151595804 CTGGCCCAGGCTGCTGCTGGTGG + Intergenic
999693648 5:154169816-154169838 CAGGTGAAGGGTGCTGTGGGTGG + Intronic
1002414630 5:179113349-179113371 CAGGGCCAGGCGGCTGACCGGGG - Exonic
1002622143 5:180495051-180495073 CCGGTCCCGGCTGCCGTCGTCGG + Intronic
1002854748 6:1026914-1026936 CAGATCTAGGGTGCTGTCGTGGG - Intergenic
1003299167 6:4861313-4861335 CAGGGCCAGGCTGGTGGCTGGGG + Intronic
1003876989 6:10446743-10446765 GAGGTCAAGGCTGCTGTGAGTGG - Intergenic
1005142092 6:22643964-22643986 CTGGTGCAGGCTGCTGGCGCGGG + Intergenic
1005841074 6:29744907-29744929 CAGGTTCAGGCTTCTATAGGAGG + Intergenic
1005870499 6:29971444-29971466 CAGGTTCAGGCTTCTGTCAGAGG + Intergenic
1005961734 6:30698550-30698572 GAGGTCAAGGCTGCAGTGGGTGG - Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006072288 6:31506648-31506670 CAGGCTCAGGCTTCTGTCAGAGG - Intronic
1006387938 6:33742346-33742368 TAGGGCCAGGGTGCTGTCTGGGG + Intronic
1006618532 6:35346164-35346186 CAGGTCCAGGCTGGTTGTGGTGG - Intronic
1006638786 6:35478282-35478304 AGGGTCCAGGCTGCTGTCCCAGG + Exonic
1007254717 6:40520698-40520720 CTGGTGCAGGCTGCAGTAGGGGG + Intronic
1009857482 6:69283311-69283333 CAGGTCTGGGCTGCTCTCTGGGG - Intronic
1014819370 6:125969865-125969887 CAGTTCCAGGATCCTGTTGGTGG + Intronic
1015169435 6:130235042-130235064 GAGGTCAAGGCTGCTGTGAGTGG + Intronic
1017235303 6:152112190-152112212 CAGCTCCAGGCTTCTGTCTATGG + Intronic
1017566454 6:155692445-155692467 CAGGTCCATGCTGCTCTAGTTGG + Intergenic
1017729929 6:157306159-157306181 AAGGTCCATGCTGCTGCCAGAGG - Intronic
1018091507 6:160349558-160349580 CAGGCGGAGGCTGCTGCCGGCGG + Intronic
1019170012 6:170128602-170128624 CAGGTGGAGGATGCTGTAGGTGG + Intergenic
1019392221 7:794927-794949 CAGGTCCAGGTTACAGTCCGCGG - Intergenic
1023358996 7:39396792-39396814 TAGGCCCATGCTGCTGTCTGTGG + Intronic
1023970693 7:44988580-44988602 CAGGCCCTGGCTGTTGTAGGAGG - Intergenic
1024482970 7:49884186-49884208 AGGGTCCAGGCTGCTGGCTGAGG + Intronic
1025230580 7:57201260-57201282 CAGGACCAGGCTGCTGATGTTGG + Intergenic
1026434599 7:70384556-70384578 CAGCTCCAGGCTGCTGTGCACGG + Intronic
1028216617 7:88140763-88140785 GAGGTCCAGGCTGCAGTGAGTGG + Intronic
1028934982 7:96454870-96454892 CAGGTCCAGGCTGCTGTGCAAGG + Intergenic
1029348795 7:99998017-99998039 AAAGTCCATGCTGCTGTCCGTGG + Intergenic
1029437284 7:100570347-100570369 CACGCGCAGGCTGCTGTCGCGGG - Intergenic
1029635777 7:101782856-101782878 CAAGTCCAGGATGCTGGCTGGGG - Intergenic
1029710946 7:102299624-102299646 CAGGTCCAGGCTGCCGTCCTGGG - Intronic
1031195581 7:118609446-118609468 CAGGTGCTGGCTGTTGTAGGTGG + Intergenic
1034893953 7:154863424-154863446 GAGGTCGAGGCTGCAGTGGGAGG - Intronic
1034945682 7:155260303-155260325 CAGGCCCAGGCTGCCGTCCAGGG - Intergenic
1035386983 7:158479727-158479749 CAGGTCCTGGCTGCTGCCTGTGG + Intronic
1035643049 8:1198385-1198407 AAGGTCCAGGCAGCTCTCTGTGG - Intergenic
1038015717 8:23512945-23512967 CAGGTCCTTCCTGCTGTCAGGGG - Intergenic
1038147765 8:24914002-24914024 GAAGTCAAGGCTGCTCTCGGCGG - Exonic
1039518273 8:38150942-38150964 CAGGTCCAGGCTGCAGCTGCGGG - Exonic
1041729300 8:61048774-61048796 CAGGGCAAGGCTGCTGTCTCAGG - Intergenic
1041933792 8:63314963-63314985 CAGGTTCAGGCTGCTGTTGCTGG + Intergenic
1042122810 8:65507033-65507055 CAGCTCCAGGCTGGTGCTGGGGG + Intergenic
1044565064 8:93653770-93653792 CATATCCAGGCTGCTTGCGGTGG - Intergenic
1046359491 8:113131745-113131767 CAGGTGCACGGTGCTGTTGGTGG - Intronic
1047499664 8:125431279-125431301 CAGGACCCGGCTGGGGTCGGGGG + Intronic
1048881856 8:138877937-138877959 CAGGTCCTGGCTGCGGCCGTCGG + Exonic
1049149156 8:141023199-141023221 CAGGCCCAGGCTGCTGTGTCTGG + Intergenic
1049175467 8:141189828-141189850 CAGGTGCAGGCGGCTGTGGGCGG - Intronic
1049193573 8:141303066-141303088 GAGGTCCAGGCTGCAGTGAGGGG - Intronic
1049360321 8:142209685-142209707 GAGGCTCAGGCTGCTGTGGGAGG - Intergenic
1049420191 8:142513023-142513045 CGGTTCGTGGCTGCTGTCGGGGG + Intronic
1049503567 8:142982291-142982313 CAGGTGCAGGCTGAGGTCGCGGG + Intergenic
1049592704 8:143469785-143469807 CAGGACCAGCCTGCTGAGGGCGG + Intronic
1052413382 9:28148779-28148801 CAGTTCCAGGCTGCTCCCTGTGG + Intronic
1055515976 9:77033308-77033330 CAGGTGGAGGTTGCTGTGGGCGG + Intergenic
1055564762 9:77557121-77557143 CAGGGCAAGGCTGCTGTGGAGGG - Intronic
1056576369 9:87858469-87858491 CAGTTCCAGGCTGCTCCCTGTGG - Intergenic
1059394905 9:114028164-114028186 CAGTTCCTGGATGCTGTCTGGGG - Intronic
1059811511 9:117860583-117860605 CAGGTCCAGGCTGGGTGCGGTGG + Intergenic
1060291505 9:122307209-122307231 CAGGCCCATGCTCCTGTAGGGGG + Intronic
1060325381 9:122609633-122609655 CAGGTCCTGGCTGCTCTCCTGGG + Intergenic
1061777088 9:132972901-132972923 CAGGTCCAGGCTCCTTACCGGGG - Intronic
1062388948 9:136326603-136326625 AAGGCCCAGGATGCTGTCGGGGG + Intergenic
1062502694 9:136858134-136858156 CGGGTCCAGGCAGCCCTCGGGGG - Intronic
1062533884 9:137013254-137013276 CACGTTCCGGCTGCCGTCGGGGG - Exonic
1062658027 9:137614222-137614244 CCGGTCCAGGCAACTGGCGGGGG - Intronic
1187148272 X:16657351-16657373 CAGGGCCAGGCTTCTCTCTGGGG + Intronic
1187257418 X:17655588-17655610 CAGAGCCAGGCGGCTGTCCGTGG + Intronic
1190223212 X:48526448-48526470 CAGTCCCAGGCTGCAGTGGGAGG - Intronic
1191779817 X:64853608-64853630 CAGCTCCTGGCTGCTGCTGGGGG + Intergenic
1197198279 X:123725532-123725554 CAGGTCGAGGCTGCAGTGAGTGG + Intronic
1202390856 Y:24369132-24369154 CAGCTTCTGGCTGCTGTCTGAGG - Intergenic
1202479928 Y:25300984-25301006 CAGCTTCTGGCTGCTGTCTGAGG + Intergenic