ID: 1160503422

View in Genome Browser
Species Human (GRCh38)
Location 18:79413715-79413737
Sequence CAGGAGACGAAGAAGGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 289}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160503422_1160503429 -3 Left 1160503422 18:79413715-79413737 CCTGGTTCCTTCTTCGTCTCCTG 0: 1
1: 0
2: 2
3: 34
4: 289
Right 1160503429 18:79413735-79413757 CTGGGCGGCAAGGTGTCCGCAGG 0: 1
1: 0
2: 0
3: 14
4: 99
1160503422_1160503431 12 Left 1160503422 18:79413715-79413737 CCTGGTTCCTTCTTCGTCTCCTG 0: 1
1: 0
2: 2
3: 34
4: 289
Right 1160503431 18:79413750-79413772 TCCGCAGGGATGTCGTGTTCTGG 0: 1
1: 0
2: 0
3: 3
4: 41
1160503422_1160503430 -2 Left 1160503422 18:79413715-79413737 CCTGGTTCCTTCTTCGTCTCCTG 0: 1
1: 0
2: 2
3: 34
4: 289
Right 1160503430 18:79413736-79413758 TGGGCGGCAAGGTGTCCGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 88
1160503422_1160503433 16 Left 1160503422 18:79413715-79413737 CCTGGTTCCTTCTTCGTCTCCTG 0: 1
1: 0
2: 2
3: 34
4: 289
Right 1160503433 18:79413754-79413776 CAGGGATGTCGTGTTCTGGCAGG 0: 1
1: 0
2: 1
3: 6
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160503422 Original CRISPR CAGGAGACGAAGAAGGAACC AGG (reversed) Intronic
900656671 1:3762143-3762165 CCAGAGATGAAGCAGGAACCAGG + Intronic
901388848 1:8929502-8929524 CAGGAGGCTAAGGTGGAACCAGG - Intergenic
902185814 1:14724575-14724597 CACAAAACGGAGAAGGAACCAGG - Intronic
903782555 1:25830754-25830776 CAGGAGACAAAAAGGGATCCAGG - Intronic
905403587 1:37719214-37719236 CAGGAGAAGCAGAAGTGACCAGG + Intronic
905409563 1:37759072-37759094 CAGAAGATGAAGAAGGAAGATGG - Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906847297 1:49206913-49206935 GAGGAGAGGAGGTAGGAACCAGG + Intronic
906933813 1:50194639-50194661 CTGGAGACCAAGAAAGAAGCAGG + Intronic
910460302 1:87441927-87441949 CTGGAGAGGAAGAAGGATCAAGG + Intergenic
911251994 1:95586941-95586963 GAGGAGAAGAATAAGGAACCTGG + Intergenic
911817317 1:102369263-102369285 CAGGAGACGGAGTGGGAACAGGG - Intergenic
912869760 1:113293429-113293451 CAGCAGAAGAGGTAGGAACCAGG - Intergenic
914901198 1:151712054-151712076 CAGGCCACGAAGAAGGAGGCTGG - Intronic
919862944 1:201754328-201754350 CAGAGGAGGAAGAAGGAATCTGG + Intronic
920667827 1:207978682-207978704 CAAGAGAGGAAGAAGGTGCCAGG + Intergenic
923434622 1:233956517-233956539 TAGGGGAAGAAGAAAGAACCAGG - Intronic
1062890801 10:1057948-1057970 CAGAAGACGAAGAAAGTTCCTGG - Intronic
1062903105 10:1160549-1160571 CAGGACACGCAGAACGAAGCTGG - Intergenic
1062969186 10:1633062-1633084 CAGGAGAGGAAGCAGGAGCACGG - Intronic
1063152674 10:3350997-3351019 AAGGAGAGGAAGAGGAAACCAGG - Intergenic
1063559350 10:7112134-7112156 CAGGACCCTAAGAAGCAACCAGG + Intergenic
1063891776 10:10637512-10637534 CAGGAGATGAGGAAAGAGCCTGG + Intergenic
1064322255 10:14316528-14316550 AAGAAGAAGAAGAAGAAACCAGG + Intronic
1064358326 10:14639977-14639999 CAGTATACAAAGAAGGAAACGGG - Intronic
1064516925 10:16160065-16160087 CAGGAGTAGAAGTAGGAACATGG - Intergenic
1064936382 10:20683294-20683316 CTGGAGAAGAAGGAGCAACCAGG + Intergenic
1067019743 10:42784486-42784508 TAGGAGACGAAGAAGATGCCCGG + Exonic
1067077858 10:43198280-43198302 CAGCAGACAGAGAAGGCACCTGG + Intronic
1067110362 10:43396269-43396291 CAGGACTCGAGGAAGGATCCTGG + Intronic
1067268226 10:44766185-44766207 CTGGAGACGAAGATAAAACCGGG - Intergenic
1068113469 10:52709511-52709533 AAGAAGAAGAAGAAGAAACCAGG - Intergenic
1069219081 10:65860709-65860731 CAGAAGAAGAAGAAAGAAACAGG + Intergenic
1069582325 10:69574254-69574276 GAGGAGGGGAGGAAGGAACCAGG + Intergenic
1070139521 10:73728441-73728463 TAGGAGACGAAGAAGATGCCTGG - Intergenic
1070480891 10:76881847-76881869 AAGGAGAGGAAGAGGTAACCTGG + Intronic
1073482032 10:103791992-103792014 CAGGAGAGGCAGGAGGAAGCTGG + Intronic
1074666589 10:115733653-115733675 CAGGACAGGAATGAGGAACCAGG - Intronic
1075812343 10:125233667-125233689 AAGGAGGTGAAGAAGGAATCCGG - Intergenic
1076704511 10:132293856-132293878 CCGGGGACGCAGAAGGAGCCAGG + Intronic
1076805524 10:132856598-132856620 CAGGAGATGAAGAAGGCACCAGG - Intronic
1077328713 11:1974666-1974688 CAGGAGACGGAGAACGGAGCCGG - Intronic
1078001410 11:7499680-7499702 TAGGAGAAGCAGAAGGAACATGG + Intronic
1079017093 11:16878459-16878481 TACTAGACGAAGATGGAACCAGG - Intronic
1079494770 11:21029706-21029728 CAGGAGAAGAAGAAGAGAACAGG + Intronic
1080325019 11:31061565-31061587 AAGAAGAAGAAGAAGGCACCTGG + Intronic
1081777935 11:45689018-45689040 CAGGAGACTAAGAGTGAGCCAGG + Intergenic
1084486774 11:69452852-69452874 GTGGAGAGGTAGAAGGAACCTGG + Intergenic
1085558116 11:77444222-77444244 TAGGAGAATAAGAAGGAAACTGG - Intronic
1087728518 11:101751911-101751933 CAGGAGACGAAGAAGAGGCATGG - Intronic
1088771969 11:113044143-113044165 CAGGTGAACAGGAAGGAACCAGG - Intronic
1089006528 11:115096146-115096168 CAGGAGCCGAAGGAGACACCTGG + Intergenic
1089276153 11:117337298-117337320 AAGGAGAGGAAGAAAGGACCAGG - Intronic
1089629611 11:119776121-119776143 TAGGACACAAAGAAGAAACCTGG + Intergenic
1089849363 11:121482953-121482975 CAGGAGACCAAGAAGGAAGTGGG - Intronic
1090600457 11:128364472-128364494 CATGAGATGAAGGAAGAACCGGG + Intergenic
1202811692 11_KI270721v1_random:29845-29867 CAGGAGACGGAGAACGGAGCCGG - Intergenic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1094404002 12:30094945-30094967 CAGGAGAAGAAGAAGGAGCGGGG - Intergenic
1096320617 12:50609475-50609497 CAGTAGATGATGAAGGAACAGGG - Intronic
1096532165 12:52249015-52249037 CAGGAGACTGAGAAGGCACATGG + Intronic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1098944661 12:76576149-76576171 CAGGAGATTAATAAGGAAACAGG + Intergenic
1100428926 12:94512993-94513015 CAGAAGACGAAGGAGGAGCAAGG + Intergenic
1101866497 12:108524349-108524371 CCGGAGACCAGGAAGGCACCAGG - Exonic
1102038206 12:109783950-109783972 CAGGAGAGAATGGAGGAACCAGG + Intronic
1102200359 12:111053739-111053761 CGGGAGACCAACAAGGAACTGGG - Intronic
1104626111 12:130356419-130356441 CAGGACACGCAGAAGACACCGGG + Intronic
1104688772 12:130808318-130808340 CAGGAGAGGAAGGAGGAAAGGGG - Intronic
1105886541 13:24647474-24647496 CAGGTGACCAGGGAGGAACCTGG + Intergenic
1109117004 13:58401126-58401148 CAGGAGTGGAAGCAGAAACCAGG + Intergenic
1109585097 13:64390062-64390084 CAGATGATGAAGAAAGAACCAGG + Intergenic
1109807247 13:67459652-67459674 CAGAAGATGAAGAAGGAAATAGG + Intergenic
1112476702 13:99737726-99737748 CATGGGACAAACAAGGAACCTGG - Intronic
1112765339 13:102735887-102735909 CAGGAAAGCAAAAAGGAACCTGG - Exonic
1113078445 13:106491718-106491740 CGGGAGGGGAAGGAGGAACCTGG + Exonic
1113211039 13:107981653-107981675 AAGGAAAGAAAGAAGGAACCTGG - Intergenic
1113818622 13:113194375-113194397 CAGGAGACAAAAAGGAAACCTGG + Intronic
1114545804 14:23499673-23499695 AAAGAGACCAAGAAGGAACAGGG - Intronic
1115841996 14:37482692-37482714 CAGGTGTCGAGGGAGGAACCTGG - Intronic
1117911511 14:60642164-60642186 CAGGAAGCGAAGAAGGAGACAGG + Intergenic
1118885993 14:69866237-69866259 CTGGAGAGGAAGAAGGACCCTGG - Intronic
1119040760 14:71272225-71272247 GAGGAGCCACAGAAGGAACCTGG - Intergenic
1120985576 14:90331807-90331829 AACGAGCCGAAGAAGGCACCTGG - Intronic
1121153999 14:91665948-91665970 CAGGTGTTGAGGAAGGAACCAGG + Intronic
1121776211 14:96592764-96592786 CAGGAGCCGGAGCAGGAACAGGG - Intergenic
1121926094 14:97928604-97928626 CAGAAGATGAAGAAGGGAACAGG + Intronic
1122254883 14:100469246-100469268 CAGGAGACGCAGAGGGAAAATGG + Intronic
1125768174 15:42148805-42148827 CAGGAGACGAAAAGAGAACAGGG - Intronic
1125780067 15:42257346-42257368 CAAGAGAGGAAGAAGGAAAGAGG - Intronic
1125795793 15:42403095-42403117 CAGGAGCAGCAGAAGGACCCTGG - Intronic
1126049662 15:44674392-44674414 CAGGAGAGGGAGAGGGATCCTGG - Intronic
1126281585 15:46957874-46957896 CAGGGAATGAAGCAGGAACCAGG + Intergenic
1126303202 15:47223060-47223082 CAGGAGTATAAGATGGAACCTGG - Intronic
1126406765 15:48330907-48330929 TAGGAGTCGAACAAGGATCCCGG - Intergenic
1127698401 15:61473774-61473796 CAGGAGAGAAAGAAGGAAGGAGG + Intergenic
1128247731 15:66144367-66144389 AAAGAGACGAAGAAAGAACAAGG - Intronic
1128561115 15:68668370-68668392 CAGGAGACAAACAATGAACAAGG + Intronic
1129056478 15:72823974-72823996 CATGAGAAGAAAAAGAAACCAGG + Intergenic
1129224150 15:74156684-74156706 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
1130357705 15:83149470-83149492 AAAGAGACTAAGAAGGAACAGGG + Intronic
1130437449 15:83915229-83915251 CAGGAGAAGAAGATGAAACAGGG - Intronic
1131152776 15:90057308-90057330 AAGGTGAGGAAGAAGGCACCTGG + Intronic
1132004092 15:98210628-98210650 AAGGAGAAAAAGAAGGAACAAGG + Intergenic
1135074941 16:19384979-19385001 CAGGAGCAGAAGAATGAACCAGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1139531296 16:67543950-67543972 CAGCAGAGGAAGGAGGGACCTGG - Intronic
1145825271 17:27872211-27872233 CAGGAGATGAAGATGGCATCGGG + Intronic
1146096340 17:29933419-29933441 CAGAAGACCTAGGAGGAACCAGG - Intronic
1146379017 17:32314815-32314837 CAGGAGACGAGGAAGAAAACAGG - Intronic
1146704716 17:34992612-34992634 CAGGAGGTGGAGAAGGAGCCGGG + Exonic
1147643128 17:42017331-42017353 CAAGAGGCGAAGAGGTAACCGGG - Exonic
1148836397 17:50467992-50468014 CAGGAAGGGAAGAAGGAACCAGG + Intronic
1150524540 17:65908399-65908421 CAGGAGATGAAAAAGGGACCGGG + Intronic
1150580912 17:66473101-66473123 CAGGAGAAGAAGGAGGAATGGGG - Intronic
1151682396 17:75628987-75629009 CAGGGGAGGAAGATGGAGCCGGG - Exonic
1152390687 17:80002061-80002083 CAGGAAACGCAGAAGGGATCCGG + Intronic
1152674175 17:81628819-81628841 CAGGAGACCAGGGAGGAGCCAGG + Intronic
1154073469 18:11176946-11176968 CAGGAGAGGAGGAAGGAGGCAGG - Intergenic
1155081189 18:22411607-22411629 CAGGAGAGCTAGAAGGAAGCTGG - Intergenic
1155365571 18:25046271-25046293 CAGGAGATGAAGAAGGAATCTGG + Intergenic
1157244426 18:46040894-46040916 CAGGAGAGGGAGAAGGAGCTGGG + Intronic
1157289231 18:46398310-46398332 CAGGGCAGGAAGAAGGAAGCAGG + Intronic
1157498170 18:48171109-48171131 CAGTAGAAGAAGATGGCACCAGG + Intronic
1159040468 18:63319602-63319624 GAGGGGACGATGAAGGAGCCGGG + Exonic
1160503422 18:79413715-79413737 CAGGAGACGAAGAAGGAACCAGG - Intronic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1160920951 19:1520327-1520349 CAGGAGACCAGGCAGGGACCAGG + Intergenic
1161312419 19:3602306-3602328 CAGGAGGCTAGGATGGAACCCGG + Intronic
1162477424 19:10908929-10908951 CAGGAGAGGGAGCAGGAAGCCGG - Intronic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1165435656 19:35793317-35793339 CAGGACACAGAGATGGAACCTGG - Intergenic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1167374179 19:49102381-49102403 CAGGAGGGGAAGGATGAACCTGG + Intronic
1167449840 19:49560621-49560643 CACGAGAAGAAGAAGGACACAGG - Exonic
1168190207 19:54732831-54732853 CAGGAAACTAAGGAGGAACAAGG + Intronic
1168205119 19:54844733-54844755 CAGGAAACTAAGGAGGAACAAGG + Intronic
925034555 2:675802-675824 CAGGAAAGGGAGAAGGAACCAGG + Intronic
925213563 2:2072649-2072671 CAGGAGTTGAGGGAGGAACCTGG + Intronic
925571867 2:5321122-5321144 CAGGAGATGAAGGAGGAACAAGG - Intergenic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
926724485 2:15986795-15986817 CAGGCGACCAAACAGGAACCTGG - Intergenic
927943787 2:27122576-27122598 CAGGGGAAGAAGGAGGAACATGG - Intergenic
931217457 2:60260003-60260025 CAGGAGACCCAGGAGGAAGCTGG - Intergenic
932331637 2:70901306-70901328 CAGGAGGCGAGGAAGCACCCCGG - Intronic
932465181 2:71917120-71917142 CATGAGAAGAAGAAGGAGCCTGG - Intergenic
932563426 2:72891312-72891334 AAGGAGACGATGAGGGAACATGG - Intronic
932672251 2:73748413-73748435 CAGGAGAGGAAGAAATGACCAGG + Intergenic
933162558 2:79041896-79041918 CTGGAAAACAAGAAGGAACCAGG - Intergenic
933648088 2:84828426-84828448 GAGGAGGGGAAGAAGGAAACAGG + Intronic
933729317 2:85445242-85445264 CCGGAGATAAAGAAGGTACCAGG + Intergenic
933844575 2:86315017-86315039 CAGGAGACCAAGGAGGAAAGAGG - Intronic
935858554 2:107302138-107302160 GAGGAGACAAAGCAGGAGCCAGG - Intergenic
936021468 2:108998234-108998256 CAGGAGACCAAGAATAAACCAGG - Intergenic
936073091 2:109384328-109384350 CAGGAGAGGAGGAAGGACCTGGG + Intronic
936866928 2:117085533-117085555 CATGGGTCGAGGAAGGAACCTGG - Intergenic
937181018 2:119996526-119996548 CAAGGAAAGAAGAAGGAACCAGG + Intergenic
937268043 2:120629686-120629708 CAGGAGAGGGAGCAGGACCCAGG - Intergenic
938257173 2:129868455-129868477 CAGGGGGCAAAGAAGGCACCTGG - Intergenic
939820772 2:146954637-146954659 CGTGAGAAGAAGAAGGATCCAGG + Intergenic
940047177 2:149422112-149422134 CAGTAGGTGAAGAAGGCACCTGG - Intronic
941660621 2:168192225-168192247 CAGCAGGCAAAGAAGGAACATGG + Intronic
942160156 2:173176635-173176657 CAGGAGACTAAGAAGGACAGGGG + Intronic
942250940 2:174047312-174047334 CAGAAGAGGAAGAAGAAGCCTGG + Intergenic
944661980 2:201928928-201928950 AAGGAGACGAACAAGCATCCTGG - Intergenic
946434665 2:219643739-219643761 CAGGACTCTAGGAAGGAACCAGG - Intergenic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
946564108 2:220944154-220944176 CCAGAGAGGTAGAAGGAACCTGG - Intergenic
946983885 2:225249562-225249584 CAGGAGAAGGAGAATGAACTGGG + Intergenic
947257649 2:228182998-228183020 GAGGAGACTAAGTAGGGACCAGG + Intergenic
947348792 2:229221336-229221358 CAGAAGTGGAGGAAGGAACCAGG - Intronic
948102252 2:235384533-235384555 CAGCAGGCGAAGAAGGAGCTGGG - Intergenic
948212642 2:236206395-236206417 CAGGATATGAACAAGGAAACGGG + Intronic
948509721 2:238455764-238455786 CAGGTGTCGAAGGAGGGACCAGG - Intergenic
948955732 2:241289268-241289290 CATGAGACAAAGGAGGAAGCAGG - Intronic
1170803846 20:19612767-19612789 CAGGAGATGAGGAAAGAAACAGG - Intronic
1170812806 20:19687762-19687784 CAGGAGAGAAATACGGAACCAGG - Intronic
1170930235 20:20762855-20762877 CAGGAGATGGAGAAGCACCCAGG - Intergenic
1172009521 20:31838285-31838307 CATGAGACGAAGCAGGAAATAGG + Intergenic
1172223312 20:33288259-33288281 GAGCAGAGGAAGAAGGAGCCAGG - Intronic
1172780665 20:37435207-37435229 CAGGAGACCAAGACAGAAGCTGG - Intergenic
1172964449 20:38824467-38824489 CAGAAGGAGAAGAAGGAACTGGG - Intronic
1173579592 20:44137589-44137611 CAGGGGAGGAAGAAGCCACCAGG + Intronic
1173714090 20:45187278-45187300 CAGGAGGTGAGAAAGGAACCTGG - Intergenic
1176257297 20:64158946-64158968 CAGGAGAAGCAGGAGGAAGCAGG - Intronic
1178278648 21:31261863-31261885 CAGGAGACCAGCAAGGAGCCCGG - Intronic
1178285490 21:31322269-31322291 CAGGAGGAGAAGAAGGAGCAAGG - Intronic
1178781192 21:35604553-35604575 CAGGAAACGAAAAAGGAGCCTGG - Intronic
1179334208 21:40434935-40434957 TAGGAAACGAAGAAAGAACATGG + Intronic
1180102259 21:45594168-45594190 CACGAGGAGAAGAAGGAACAGGG - Intergenic
1181443296 22:22949710-22949732 CAGGAGACAGAGCAGGGACCTGG - Intergenic
1182142753 22:27976045-27976067 CAAGCGACGAAGAAGGACACTGG - Intergenic
1182251804 22:29006556-29006578 CTGGAGACTGATAAGGAACCAGG - Intronic
1182626182 22:31648221-31648243 CAGGGGACGCAGCAGGAACATGG + Intronic
951643705 3:24864303-24864325 AAGGAAAAGAACAAGGAACCAGG - Intergenic
952576115 3:34775955-34775977 CAGGAGAAGAAAAAGGAATCAGG + Intergenic
952754911 3:36857560-36857582 CAGGTGACCAGGAAGGAGCCTGG - Exonic
953436559 3:42881875-42881897 CAGGAAAAACAGAAGGAACCTGG - Intronic
953487673 3:43317626-43317648 CTGGAGCCGAAGGAGCAACCAGG - Intronic
953807829 3:46086610-46086632 CAGGAGGAGAAGAAGGCACAGGG - Intergenic
954431143 3:50471441-50471463 CAGAAGAGGAAGAAGGAAGCTGG - Intronic
954456896 3:50604568-50604590 CAAGAAAAGAAGATGGAACCTGG + Intergenic
954462981 3:50638246-50638268 GAGGAGGCAAAGAAGGAACCCGG + Intronic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955465107 3:59229426-59229448 CAGAAGATGAAGAAGGAGCAAGG + Intergenic
956932409 3:74059897-74059919 AAGGAAACAAAGAAGGAAGCAGG + Intergenic
959595985 3:108128899-108128921 AAGGAGAGGCAGAAGGAAGCAGG + Intergenic
959785568 3:110294119-110294141 CAGGTGTTGAAGAAGAAACCTGG - Intergenic
959987020 3:112585318-112585340 CAGGTGTTGAGGAAGGAACCAGG - Exonic
960413195 3:117353250-117353272 CAGGAGACAAGGAAGAAGCCTGG - Intergenic
960610375 3:119549904-119549926 AATGAGACGTAGAAGGAACATGG + Intronic
960864238 3:122184150-122184172 AAGGAGACGGTGAAGGAACCGGG + Intronic
962563086 3:136628552-136628574 TAGGAGAAGAAGAAGGGAGCAGG - Intronic
966160905 3:176967398-176967420 AAGAAGCCGAAGAAGGGACCTGG + Intergenic
966246594 3:177815227-177815249 CAGAAGAAGAAGATGGAACCAGG - Intergenic
966699509 3:182831551-182831573 TAGGAAATGAAGAAGGAACCAGG - Intronic
967119161 3:186367349-186367371 CAGGAGATAAAGAAGTGACCAGG - Intergenic
967502016 3:190208617-190208639 AAGGAGACAAAGAAGAAAACAGG - Intergenic
967686931 3:192428332-192428354 CAGGAGAGGAAGAAGGGAAGGGG + Intronic
967881652 3:194305938-194305960 CTGGGGACGAAGAAGGGATCTGG - Intergenic
968276667 3:197445632-197445654 AAGGAGCAGAAGAAGGAACAGGG - Intergenic
968554277 4:1239373-1239395 CAGGAGACCAAGCAGTACCCAGG + Intronic
968568816 4:1328771-1328793 CAGGAGCCGGAGCAGGACCCCGG - Intronic
969330553 4:6471698-6471720 CTGGAGAAGAAGAGGGACCCGGG - Intronic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
971199065 4:24495452-24495474 CAGGAAAGGAAGAAGGAAGCAGG + Intergenic
971280203 4:25236726-25236748 CAGAAGATGAAGAAAGAACCAGG - Intronic
971317727 4:25581317-25581339 CAGGAGAGGAAGAAAGAGTCTGG - Intergenic
971793432 4:31198094-31198116 GAGGAGAAGGAGAAGGTACCAGG - Intergenic
972368071 4:38394500-38394522 CAGGGGACAAAGAAGGAAAGGGG + Intergenic
974434650 4:61841118-61841140 CAAGAGACGAAGAAAGAAAGGGG - Intronic
975546726 4:75568032-75568054 CAGGAAACAAAGTAGGAAGCAGG - Intergenic
977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG + Intronic
978400725 4:108327707-108327729 AAGGAGAAGAAGAAGGAAGTAGG - Intergenic
980878287 4:138684199-138684221 CAGGAGCAGAAGTAGGAACAGGG + Intergenic
981027863 4:140094764-140094786 CAGGAAAGGAGGAAGGAAGCGGG - Intronic
981831082 4:149002775-149002797 AAGGAGAGGAAGAAGTCACCAGG + Intergenic
982063790 4:151632434-151632456 CAGAAGATAAAGAAGGAAACAGG + Intronic
982090020 4:151872414-151872436 CAGGAGACCAATAAGGAGTCTGG + Intergenic
982645890 4:158025452-158025474 CATGAGACAAAGAAGGTATCTGG - Intergenic
985096406 4:186416933-186416955 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
986384297 5:7216593-7216615 CTGGAGACTAAGAAGGAAAGAGG - Intergenic
986572437 5:9179413-9179435 CAAGAGACCAAGAAGAAAACAGG + Intronic
988288821 5:29257958-29257980 CAGGAGACAAAGAAGAAAATTGG - Intergenic
988322231 5:29713355-29713377 CAGGAGACAAAAAAGGGAACAGG + Intergenic
989669439 5:43897748-43897770 CAGTAGACGAAAAAAGAAACTGG + Intergenic
990515794 5:56529893-56529915 CAGGACAAAAAGCAGGAACCAGG - Intronic
990877333 5:60500331-60500353 AAGGAGAAGAAGGAAGAACCTGG + Intronic
991927432 5:71719191-71719213 GAGGAGGCGAAGAAGGAAGGGGG - Exonic
992154280 5:73939564-73939586 CAGGAGCCGATGAAGGTCCCTGG - Intronic
992342816 5:75843781-75843803 AAGAAGAGGAAGAAGGACCCTGG + Intergenic
992631921 5:78690064-78690086 CAGGTGTTGAGGAAGGAACCTGG + Intronic
992658245 5:78931786-78931808 CAGGTGTTGAAGAAGGGACCTGG + Intronic
997606773 5:135180479-135180501 CAGTGGAGGATGAAGGAACCAGG - Intronic
997753165 5:136369571-136369593 CAAGAGACAGAGAAGGAAGCTGG - Intronic
998020871 5:138769185-138769207 CAGGAAAACAAGAAGGAGCCAGG - Intronic
998252997 5:140564966-140564988 CAGGAGCCGCAGAAGAAACAAGG - Exonic
999418332 5:151419073-151419095 CAGAAGGCGAAGAAGAAACCAGG - Intergenic
1000329959 5:160198447-160198469 CATGATAGGAAGAAGGAACGTGG - Intronic
1004905870 6:20236442-20236464 CAGGTGAAGATGAAGGAACTAGG + Intergenic
1006185516 6:32179569-32179591 CAGGAGATGAAGAGGGAAATGGG + Intronic
1008043650 6:46829614-46829636 GAGGAGAAGAAGCAGGATCCCGG - Intronic
1010262626 6:73833722-73833744 CAGGACAGGAAGCAGGAACTGGG - Intergenic
1010373705 6:75141425-75141447 CAGCAGACGGAGCAGGAAGCAGG + Intronic
1013120839 6:107139124-107139146 CAAGAAAGGAAGAAGAAACCTGG + Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1015464805 6:133536993-133537015 AAGGATAAGAAGAAGGAACATGG - Intergenic
1016562723 6:145414972-145414994 CAGGAGACAAAGTAGGATACGGG - Intergenic
1016990163 6:149922969-149922991 CGGGAGGCGTAGAAGGAACGCGG + Exonic
1018031011 6:159841750-159841772 CAGGAGACATAGTAGGAACAGGG - Intergenic
1018836430 6:167487724-167487746 CAGCAGGGGAAGAAGGAGCCTGG - Intergenic
1019180706 6:170186055-170186077 CAGGAGAGCAGGAAGGAAACGGG - Intergenic
1020241196 7:6396419-6396441 CTGGGGACGAAGAAGGAACAAGG + Intronic
1022059880 7:26782998-26783020 CAGGAGAGGCAGAAAGAATCTGG - Intronic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1024618865 7:51139886-51139908 CAGGAGACAACCAAGGAAACTGG - Intronic
1024787242 7:52922372-52922394 CAGGAGATGGAGAAAGAAACAGG + Intergenic
1030152862 7:106424121-106424143 CAGGTGAGGAAGAAGGTAGCAGG - Intergenic
1030893841 7:115031888-115031910 GAGGAGATGAAGAATGAACTTGG + Intergenic
1031096634 7:117427990-117428012 TAGGAGCCGACGAAGGAGCCAGG + Intronic
1032846950 7:135759187-135759209 CAGGAGACCAAGTAGGAAAAGGG + Intergenic
1034159167 7:148980102-148980124 CAGGTGTTGAGGAAGGAACCTGG - Intergenic
1035675190 8:1451198-1451220 CAGGTGTAGAAGGAGGAACCAGG - Intergenic
1035954901 8:4066224-4066246 CAGGAGACAAAGAAGGAAGGAGG - Intronic
1036163098 8:6406910-6406932 CGGGAGACGAAGCAGGCAGCCGG - Intronic
1036604498 8:10293697-10293719 CAGGAGGGGAGGAAGGAAACAGG - Intronic
1037266854 8:17072842-17072864 AAGGAGAACAAGAAGGAACCAGG + Intronic
1038610326 8:29054825-29054847 CATCACAGGAAGAAGGAACCTGG + Intronic
1039221677 8:35338732-35338754 AAGGCGAGGAAGAAGGAAACTGG - Intronic
1039745258 8:40419840-40419862 CAGGGAAGGAAGAAGGAATCTGG + Intergenic
1039805491 8:40994224-40994246 AAGAAGAAGAAGAAGGAACCGGG - Intergenic
1045370147 8:101514913-101514935 AAGGAGAAGAAGAAAGAACAAGG - Intronic
1045698086 8:104833986-104834008 CAGCAGAAGGAGAAGGAACATGG - Intronic
1048808590 8:138264034-138264056 CAGGAGATGAAGATGGAGCAGGG - Intronic
1048870621 8:138794025-138794047 CAGGGTATGAAGAAGGCACCCGG - Intronic
1049215903 8:141408087-141408109 CAGGAGAAGCGAAAGGAACCAGG + Intronic
1049311490 8:141936073-141936095 CAGGAGACCCAGGAGGGACCAGG - Intergenic
1049436459 8:142588361-142588383 CAGGAGACAACGAAGGCAGCCGG - Intergenic
1050565209 9:6875124-6875146 CTGGAGAAGAGGAAGGAAACGGG - Intronic
1051555880 9:18382015-18382037 CAGGAGAAGCAGAAGCAATCAGG - Intergenic
1053156173 9:35781258-35781280 CTGGAGAGGAAGATGGAGCCAGG + Intergenic
1055505525 9:76944405-76944427 GAGGAGACTGAGAAGCAACCAGG - Intergenic
1055949169 9:81714667-81714689 CAAGAGCAGAAGAGGGAACCAGG + Intergenic
1056823458 9:89860560-89860582 AGGGAGAGCAAGAAGGAACCTGG - Intergenic
1057478699 9:95426968-95426990 CAGGAGCCGGGGCAGGAACCCGG - Intergenic
1057619146 9:96619540-96619562 CAGGAGCCGGAGGAGGAGCCCGG + Exonic
1057816458 9:98299499-98299521 GAGGAGATGCAGAAGGATCCTGG + Intronic
1058171859 9:101691380-101691402 TAGGAGAGGAAGAAGAAACTAGG + Intronic
1059627150 9:116079470-116079492 GAGGGGATGAAGAAGGAACCTGG - Intergenic
1060042111 9:120308694-120308716 CAGGAGGCCTAGAGGGAACCAGG - Intergenic
1061039497 9:128131723-128131745 AGGGAGAGCAAGAAGGAACCTGG + Intergenic
1061070092 9:128304322-128304344 AAGGAGACTGAGAAGGAACCAGG + Intergenic
1061440911 9:130602815-130602837 AAGGAGCTGAAAAAGGAACCTGG - Intronic
1061575093 9:131501421-131501443 CAGGAGATCAAGAAGGAGCGAGG + Intergenic
1062538946 9:137033014-137033036 CTGGTGTAGAAGAAGGAACCTGG - Exonic
1187604177 X:20865112-20865134 CAGGAGACGAGGAAAGAACATGG + Intergenic
1190012547 X:46797815-46797837 GAGAAGACAAAGCAGGAACCTGG - Intergenic
1190757408 X:53412942-53412964 AAGGAGAAGAAGAAGGAGCTGGG - Exonic
1192547724 X:72027631-72027653 CAGGAGCTGAAGGAGGGACCAGG - Intergenic
1192591563 X:72364235-72364257 AAGGAGACTGAGAAGGAACAGGG - Intronic
1194807411 X:98346666-98346688 CAGGAGAGGATGGAGGAACTTGG - Intergenic
1194931102 X:99888186-99888208 CAGGAGCTGAAGACGGAACCCGG - Intergenic
1195068002 X:101254792-101254814 CAGGAGAGGGAGGAGGAAACAGG + Intronic
1195925974 X:110025113-110025135 CAGGAGAGGAGGAAAGAGCCTGG - Intronic
1196117520 X:112013628-112013650 CAGGATACAATGAAGGAAGCAGG - Intronic
1199802118 X:151261937-151261959 GAGGAGAGGAGGAACGAACCTGG + Intergenic