ID: 1160505230

View in Genome Browser
Species Human (GRCh38)
Location 18:79423096-79423118
Sequence GAGGGTTGGGGCGCGTACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160505217_1160505230 20 Left 1160505217 18:79423053-79423075 CCAAAGCTGTTGTGAGGCTCACG No data
Right 1160505230 18:79423096-79423118 GAGGGTTGGGGCGCGTACAGAGG No data
1160505215_1160505230 27 Left 1160505215 18:79423046-79423068 CCTGTGTCCAAAGCTGTTGTGAG No data
Right 1160505230 18:79423096-79423118 GAGGGTTGGGGCGCGTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160505230 Original CRISPR GAGGGTTGGGGCGCGTACAG AGG Intronic