ID: 1160507619

View in Genome Browser
Species Human (GRCh38)
Location 18:79436295-79436317
Sequence TGGGAGCCGTTGGGAACAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160507610_1160507619 17 Left 1160507610 18:79436255-79436277 CCGTGGGTAGTGGGCGCTGCGGG 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1160507619 18:79436295-79436317 TGGGAGCCGTTGGGAACAACTGG 0: 1
1: 0
2: 0
3: 9
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160507619 Original CRISPR TGGGAGCCGTTGGGAACAAC TGG Intronic
903299636 1:22369608-22369630 TGGAAGCGGTTGGGAGCCACAGG - Intergenic
908519096 1:64923809-64923831 TGGGAGGCGTTGGGAACCGTTGG - Intronic
908639207 1:66203626-66203648 CAGGAGCCGATGCGAACAACTGG - Intronic
911033157 1:93510818-93510840 CAGGAGCCGATGGGATCAACTGG + Intronic
911964158 1:104344672-104344694 AAGAAGCCGTTGGGAACCACGGG - Intergenic
912132628 1:106620568-106620590 TGGGAGACGCTAGGAACCACAGG - Intergenic
912711434 1:111952774-111952796 TGGGAGTGGTTGGGAAGCACTGG - Intronic
912864824 1:113247706-113247728 AGGGAGTCGCTGGGAGCAACAGG - Intergenic
916260717 1:162839563-162839585 TGTGAGACCTTGGGAACATCAGG + Intronic
921902252 1:220463277-220463299 TGGGAGCCCTTGGGCACCCCAGG + Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924738762 1:246782150-246782172 TGGGGGCAGCAGGGAACAACAGG + Intergenic
1065617385 10:27542137-27542159 TTGGAGCCCTTGGGAACTTCTGG + Exonic
1066818359 10:39451263-39451285 CAGGAGCCGTTGCGATCAACTGG - Intergenic
1069555024 10:69392215-69392237 GGGGGGCCTTTGGGGACAACGGG + Exonic
1072013842 10:91326631-91326653 CAGGAGCCGATGGGATCAACTGG - Intergenic
1073845978 10:107555254-107555276 AGGGAGGCCATGGGAACAACAGG - Intergenic
1074655809 10:115586532-115586554 CAGGAGCCGATGCGAACAACTGG - Intronic
1076725391 10:132410643-132410665 TGGGAGCCGTGAGGGCCAACGGG + Intronic
1078606920 11:12785146-12785168 TGGGAGCCGTGGGGAACGTGTGG + Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083317609 11:61826307-61826329 TGGGAGCCGCTGGGGACCCCAGG + Intronic
1087722527 11:101683179-101683201 TAGGAGCCGATGCGATCAACTGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1095312925 12:40722057-40722079 TTTGAGCCGTGGGGAACAACAGG + Intronic
1099232178 12:80039659-80039681 TGGGAGCAATTGGGAACCACAGG + Intergenic
1099538277 12:83872318-83872340 CAGGAGCTGTTGAGAACAACTGG + Intergenic
1100341319 12:93682414-93682436 TGGGAGGCCTTGAGAACAAATGG + Intronic
1107639422 13:42426107-42426129 CAGGAGCCGATGGGATCAACTGG + Intergenic
1111007788 13:82272087-82272109 TGGGAGCAGTTGGAAACACAAGG - Intergenic
1112116277 13:96358670-96358692 TTGGGGGCTTTGGGAACAACTGG + Intronic
1113549924 13:111184843-111184865 TGGGAGCAGGTGGGGAGAACCGG + Intronic
1116314654 14:43371491-43371513 CGGGAGCCGATGTGATCAACTGG + Intergenic
1116322942 14:43493404-43493426 CAGGAGCCGATGGGATCAACTGG + Intergenic
1116331191 14:43599114-43599136 CAGGAGCCGATGGGATCAACTGG + Intergenic
1117188846 14:53271189-53271211 CGGGAGCCGATGCGATCAACTGG - Intergenic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1119814635 14:77554933-77554955 TGGGAGCCCATGGGAATAGCAGG - Intronic
1120865763 14:89294081-89294103 CAGGAGCCCTTGGGAAGAACGGG - Intronic
1121540107 14:94719289-94719311 TGGGAGACATTTGGAATAACGGG - Intergenic
1122059206 14:99125312-99125334 TGGGAGCCGTGGGGAAAGAGAGG + Intergenic
1126788084 15:52195533-52195555 TGGGAACCATTGGGAAGCACAGG + Intronic
1128415780 15:67444569-67444591 TGGGAGGTGATGGGGACAACAGG + Intronic
1128450443 15:67803101-67803123 TGGGAGCCAGTGGGCACATCAGG + Intronic
1134368686 16:13603495-13603517 TGTGAGCTGTTGGGCAAAACTGG + Intergenic
1134680230 16:16119924-16119946 TGGGAGGCGGTGGGAACAGCTGG + Intronic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1138884591 16:61060902-61060924 TGGCAGCTGCTTGGAACAACTGG - Intergenic
1142437065 16:90067087-90067109 TGTGAGTTGTTGGGAACTACAGG + Intronic
1146624445 17:34424838-34424860 AGGGAGCAGCTGGGAACATCCGG + Intergenic
1151975774 17:77482895-77482917 TGGGGGGCTTTGGAAACAACAGG - Intronic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1159648763 18:70952600-70952622 TGGGAGAAGTTGGGAAGAAATGG - Intergenic
1160507619 18:79436295-79436317 TGGGAGCCGTTGGGAACAACTGG + Intronic
1160915883 19:1496293-1496315 TGGGAGCCATGCAGAACAACAGG - Exonic
1162584377 19:11550016-11550038 TGGGCGCTGTTGGGGACACCCGG - Exonic
1164584783 19:29460516-29460538 TAGGAGCCGATGCGATCAACTGG + Intergenic
1165070937 19:33254483-33254505 TGGGGGCCGTGGGGAGCAGCAGG + Intergenic
1165397137 19:35570656-35570678 TGGGAGACCTTGGGAAGAAGTGG + Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1167704623 19:51072455-51072477 TGGTAGCCGTTAGCCACAACTGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925470846 2:4159038-4159060 CAGGAGCCGATGGGATCAACTGG + Intergenic
925731512 2:6922314-6922336 TGGGAGCCTGTGGGAGCAAAAGG + Intronic
927483590 2:23473321-23473343 TGGGAGAGGTGGGGAAGAACAGG + Intronic
928575822 2:32653999-32654021 TGGGACCCTTGGGGAAGAACTGG - Intronic
940623594 2:156145102-156145124 TGGGAGTTTTTGGGAACATCTGG - Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941694313 2:168534704-168534726 TGGGTGGCATGGGGAACAACAGG + Intronic
947574121 2:231258879-231258901 TGGGAGCCCATGGGAACAGCAGG + Intronic
1169559729 20:6787089-6787111 TGGGATCCGTTGGGACCCAGAGG - Intergenic
1169600110 20:7248768-7248790 TGGCAGCCGTGTGGAACAAAGGG + Intergenic
1172389623 20:34558368-34558390 TGGGCGCCGTGGGAAACAGCCGG - Intronic
1173287685 20:41687947-41687969 TGGGAGCCATGGGGAACCTCAGG - Intergenic
1174577516 20:51547061-51547083 TGAAAGCAATTGGGAACAACTGG + Intronic
1176064948 20:63189419-63189441 TGGGAGCCCTGGGCAAGAACAGG - Intergenic
1178244706 21:30939158-30939180 TGGGAGACTTTGGAAAAAACTGG + Intergenic
1178593264 21:33930364-33930386 CAGGAGCCGATGGGATCAACTGG - Intergenic
1184514712 22:44954948-44954970 TGGGAGCAGGCGGGGACAACAGG + Intronic
1185017018 22:48350577-48350599 AGGGAGCTGTCAGGAACAACAGG + Intergenic
950958339 3:17079135-17079157 TGAGAGCCCTTGGAAACACCAGG - Intronic
951175568 3:19595038-19595060 CAGGAGCCGTTGCGATCAACTGG - Intergenic
951818687 3:26784323-26784345 CAGGAGCCGATGCGAACAACTGG + Intergenic
958704937 3:97642653-97642675 TAGGAGCCGATGCGATCAACTGG + Intronic
961452839 3:127010180-127010202 TCGGAGCCTTTGGGGACAACCGG + Intronic
961452859 3:127010270-127010292 TCAGAGCCTTTGGGGACAACTGG + Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
964318642 3:155470289-155470311 TAGGAGCCGATGCGATCAACTGG + Intronic
966743004 3:183251346-183251368 TGGGAGATGGTGGGAGCAACAGG - Intronic
970219998 4:13800212-13800234 TAGGAGCCGATGCGATCAACTGG + Intergenic
970692581 4:18636594-18636616 TGGGAGCCTTTGCCAACAATAGG - Intergenic
971887886 4:32476242-32476264 TGGGAGCAGCTGGGACCCACAGG - Intergenic
973731599 4:53828410-53828432 CAGGAGCCGATGGGATCAACTGG - Intronic
974152409 4:58026537-58026559 CAGGAGCCGATGGGATCAACTGG + Intergenic
976600742 4:86935394-86935416 TGGGAGCCCTCGGGGAGAACGGG + Intronic
977264076 4:94833606-94833628 TGGGGGCTGATGGGAACATCAGG - Intronic
985754036 5:1702540-1702562 TGGGAGGCGTTGGAAAGACCCGG - Intergenic
987172480 5:15272624-15272646 CGGGAGCCGATGCGATCAACTGG + Intergenic
987863985 5:23517660-23517682 TGTGAGTTGTTGGGAACTACAGG - Intronic
988568472 5:32340847-32340869 TGAGACCCTTTGGGAAAAACAGG - Intergenic
1001324347 5:170710703-170710725 TGGAATCCCTTGAGAACAACTGG - Intronic
1005805307 6:29468670-29468692 TGGCAGCCCTTGGGAATCACAGG - Intergenic
1007928974 6:45674156-45674178 CGGGAGCCGATGCGATCAACTGG - Intergenic
1012776127 6:103495946-103495968 TAGGAGCCGATGCGATCAACTGG - Intergenic
1013589063 6:111605184-111605206 ACGGAGCCTTTGGGAACAAGGGG - Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1019572489 7:1719523-1719545 TGGGAGGCTTGGGGAACAACAGG - Intronic
1022520020 7:31000295-31000317 GAGGAGCCCTTGGGAACATCTGG + Intergenic
1024141750 7:46469059-46469081 TGGGAGCCTTTTGGATCAATTGG - Intergenic
1025184019 7:56843161-56843183 TAGGAGCCGATGCGATCAACTGG - Intergenic
1025197683 7:56945246-56945268 GGGGAGCAGTTGGAAATAACAGG + Intergenic
1025674264 7:63631692-63631714 GGGGAGCAGTTGGAAATAACAGG - Intergenic
1026365020 7:69639640-69639662 TAGGTGCCCTTGGGCACAACAGG - Intronic
1028117427 7:87015720-87015742 TGGGAGCAGTTGGGAGTAGCTGG - Intronic
1028944005 7:96556969-96556991 CGGGAGCCGATGTGATCAACTGG - Intronic
1028947964 7:96602171-96602193 TGGGAGCCATTGGTAAGAAGAGG + Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1032994069 7:137425762-137425784 CGGGAGCCGATGCGATCAACTGG + Intronic
1039517222 8:38144243-38144265 TGGGCACAGTTGGGAACAGCAGG + Exonic
1041315938 8:56562624-56562646 TGGGAGCCGTTGGGATCATGGGG + Intergenic
1043009857 8:74867749-74867771 CAGGAGCCGATGTGAACAACTGG + Intergenic
1043016607 8:74947430-74947452 CAGGAGCCGATGTGAACAACTGG - Intergenic
1043241640 8:77941731-77941753 CAGGAGCCGTTGCGATCAACTGG + Intergenic
1046468382 8:114636068-114636090 CAGGAGCCGATGCGAACAACTGG - Intergenic
1046982305 8:120349599-120349621 CGGGAGCCGATGCGATCAACTGG + Intronic
1056519257 9:87385023-87385045 TGGGAGGTGCTGGGAACACCTGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059341612 9:113600636-113600658 TGGGAGCAGTTGGGGTCAGCTGG + Intergenic
1060594673 9:124840919-124840941 GGGGAGCCGTGGTGAGCAACAGG - Intergenic
1060863704 9:126977963-126977985 TGGGAGCAGTTGGTACCCACAGG + Intronic
1062363729 9:136199207-136199229 TGGGAGCGATTGGCAAAAACGGG + Intronic
1062717877 9:138020242-138020264 TGGGTGCTGTGGGGAACTACAGG - Intronic
1185482885 X:460703-460725 TGGGAGCCGTTGGGTAAAGCGGG + Intergenic
1187816682 X:23239741-23239763 CAGGAGCCGATGGGATCAACTGG + Intergenic
1190027684 X:46940743-46940765 GGGAAGAGGTTGGGAACAACAGG - Intronic
1190400029 X:50024257-50024279 CGGGAGCCGATGCGATCAACTGG - Intronic
1190403361 X:50061370-50061392 CGGGAGCCGATGCGATCAACTGG + Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192077911 X:68018713-68018735 TGGGAGCCCTTGGGACTAAAGGG + Intergenic
1197749091 X:129952874-129952896 TCGGAGCCGTTGAGAGCAAGCGG - Intergenic
1198098777 X:133405667-133405689 TGGGGGCCGATGGGAATCACAGG - Intronic
1198522112 X:137463466-137463488 TGGGAGCCTTTGGAAACCATTGG - Intergenic
1199679627 X:150215832-150215854 TGGGAGCCTGTGGGAAAGACAGG - Intergenic
1199695604 X:150341217-150341239 TGGGAGCCTGTGGGAAAGACAGG + Intergenic
1200035159 X:153321876-153321898 TTGGAGCCTCTGGGAGCAACAGG + Intergenic
1201536304 Y:15052466-15052488 CAGGAGCCGATGCGAACAACTGG - Intergenic
1201967335 Y:19752742-19752764 CAGGAGCCGATGCGAACAACTGG - Intergenic