ID: 1160508884

View in Genome Browser
Species Human (GRCh38)
Location 18:79442312-79442334
Sequence CAGGACCGACGCCTCGGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 29}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160508884_1160508888 6 Left 1160508884 18:79442312-79442334 CCCTCGCCGAGGCGTCGGTCCTG 0: 1
1: 0
2: 0
3: 12
4: 29
Right 1160508888 18:79442341-79442363 AGCCTCTGCTGCCTTCGTGCAGG 0: 1
1: 0
2: 1
3: 39
4: 402
1160508884_1160508891 30 Left 1160508884 18:79442312-79442334 CCCTCGCCGAGGCGTCGGTCCTG 0: 1
1: 0
2: 0
3: 12
4: 29
Right 1160508891 18:79442365-79442387 GACAGCGCACGTGCCATTCACGG 0: 1
1: 0
2: 0
3: 0
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160508884 Original CRISPR CAGGACCGACGCCTCGGCGA GGG (reversed) Intronic
900811052 1:4801654-4801676 CAGGTCCGCCCCCTCGGCCACGG - Intergenic
904886669 1:33743398-33743420 CAGGACGGGCGCCTCGGCGGTGG + Exonic
920848360 1:209611937-209611959 CAGGACAGGTGCCTCGGTGATGG - Exonic
1084710775 11:70842635-70842657 CAGGACCCACTCCTGGCCGAGGG - Intronic
1085540097 11:77259596-77259618 CAGGAAAGAAGCCTGGGCGATGG - Intronic
1091219401 11:133921070-133921092 CATGTCCGTCTCCTCGGCGAAGG + Exonic
1091473824 12:753078-753100 CAGGTCCGACGCCCGGGCGGTGG - Exonic
1091700223 12:2654139-2654161 CAGAACCCAGGCCTCGGGGAGGG - Intronic
1106512063 13:30421184-30421206 TAGGACCCGCGCCTCAGCGAGGG - Intergenic
1112329206 13:98464000-98464022 CAGGACCTACGCCTGGGCTCTGG + Intronic
1124371373 15:29106547-29106569 AAGGACCGAGGCCTCTGCCAAGG - Intronic
1127172616 15:56319184-56319206 CAGGACCAACCCCTCTGTGATGG + Intronic
1131054781 15:89368807-89368829 CAGGGCCGACCCGTCGGGGAGGG - Intergenic
1136466236 16:30445706-30445728 CATGGCGGAAGCCTCGGCGACGG - Exonic
1152318903 17:79597035-79597057 CAGGAGGGAGGCCTCGGCCAGGG - Intergenic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1160508884 18:79442312-79442334 CAGGACCGACGCCTCGGCGAGGG - Intronic
1160767738 19:815888-815910 CTGGACAGACGCCTCCGCGAGGG - Intronic
1176547714 21:8208766-8208788 CGGGACGGACGCCTCGGGGAAGG - Intergenic
1176555611 21:8252972-8252994 CGGGACGGACGCCTCGGGGAAGG - Intergenic
1176574541 21:8436000-8436022 CGGGACGGACGCCTCGGGGAAGG - Intergenic
1176611153 21:8987292-8987314 CGGGACGGACGCCTCGGGGAAGG - Intergenic
1179209562 21:39313631-39313653 CTGGACCGACGCCTCCGCGGGGG + Exonic
1203252588 22_KI270733v1_random:125051-125073 CGGGACGGACGCCTCGGGGAAGG - Intergenic
1203260644 22_KI270733v1_random:170137-170159 CGGGACGGACGCCTCGGGGAAGG - Intergenic
953705168 3:45225594-45225616 CAGGACCTGCGCCTCTGCGTGGG - Exonic
968213377 3:196867952-196867974 CAGGCCGGACGCCTCGTCGCTGG + Exonic
971163419 4:24157648-24157670 CAGGACTGACTCCTCGGCTTTGG - Intergenic
1005687338 6:28267330-28267352 CAGGGCCGACACCTCCGCTACGG - Intronic
1013507445 6:110814773-110814795 CGGGACCGACGCCTCGGACCGGG + Intronic
1018185798 6:161264599-161264621 CAAGACGGAAGCCTCAGCGAGGG - Intronic
1020418128 7:7969164-7969186 CACCCCCGCCGCCTCGGCGAGGG - Exonic
1023939744 7:44761914-44761936 CAGCACCGCCCCCTCGGCGCAGG - Intronic
1025130750 7:56373222-56373244 CAGGACTCACGCCTCTGCGCAGG + Intergenic
1029642951 7:101832529-101832551 CAGGACCCACACTTCGGCGTTGG + Intronic
1037450748 8:19013858-19013880 CGGGGCCGACGCCTCGGGGAGGG + Intronic
1038491590 8:27975780-27975802 CAGGGCAGACGGCTCAGCGAGGG + Intronic
1049973619 9:842005-842027 CAGGTCCGACGCCCCGGAGCCGG - Exonic
1051599668 9:18860314-18860336 CAGGACCAACCCCTGGTCGAGGG - Intronic
1062582444 9:137234542-137234564 CAGGACAGAGGCCTCGGGAACGG + Intronic
1203468992 Un_GL000220v1:108202-108224 CGGGACGGACGCCTCGGGGAAGG - Intergenic
1203476813 Un_GL000220v1:152174-152196 CGGGACGGACGCCTCGGGGAAGG - Intergenic