ID: 1160510677

View in Genome Browser
Species Human (GRCh38)
Location 18:79451836-79451858
Sequence GCCGAAGCCCAGGCCGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 177}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160510677_1160510682 -8 Left 1160510677 18:79451836-79451858 CCATCTGCGGCCTGGGCTTCGGC 0: 1
1: 0
2: 1
3: 23
4: 177
Right 1160510682 18:79451851-79451873 GCTTCGGCGCTGGTGGGAACCGG 0: 1
1: 0
2: 1
3: 8
4: 93
1160510677_1160510689 28 Left 1160510677 18:79451836-79451858 CCATCTGCGGCCTGGGCTTCGGC 0: 1
1: 0
2: 1
3: 23
4: 177
Right 1160510689 18:79451887-79451909 GAGCAGGACCCACCTGTGCACGG 0: 1
1: 0
2: 1
3: 27
4: 235
1160510677_1160510684 6 Left 1160510677 18:79451836-79451858 CCATCTGCGGCCTGGGCTTCGGC 0: 1
1: 0
2: 1
3: 23
4: 177
Right 1160510684 18:79451865-79451887 GGGAACCGGTTCCCAGTCGGTGG 0: 1
1: 0
2: 0
3: 2
4: 37
1160510677_1160510686 12 Left 1160510677 18:79451836-79451858 CCATCTGCGGCCTGGGCTTCGGC 0: 1
1: 0
2: 1
3: 23
4: 177
Right 1160510686 18:79451871-79451893 CGGTTCCCAGTCGGTGGAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 89
1160510677_1160510683 3 Left 1160510677 18:79451836-79451858 CCATCTGCGGCCTGGGCTTCGGC 0: 1
1: 0
2: 1
3: 23
4: 177
Right 1160510683 18:79451862-79451884 GGTGGGAACCGGTTCCCAGTCGG 0: 1
1: 0
2: 0
3: 8
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160510677 Original CRISPR GCCGAAGCCCAGGCCGCAGA TGG (reversed) Intronic
900494071 1:2968479-2968501 GCCGGCCCCCAGGCTGCAGAGGG - Intergenic
900578443 1:3395648-3395670 GCCCTGGCCCAGGCCTCAGATGG + Intronic
901089965 1:6634629-6634651 GCCGAGGTCCAGGCCGTGGAGGG + Exonic
901129516 1:6953541-6953563 ACCGAAGCCCAGGCCCCGCAGGG + Intronic
901274888 1:7983563-7983585 TGCGAAGGCCAGACCGCAGAGGG + Intronic
901863406 1:12088897-12088919 GCTGAAGCCCAGGATGAAGAGGG - Intronic
902385029 1:16071669-16071691 GAGGAAGCCCAGGCTGCAGAAGG + Intronic
902404686 1:16176101-16176123 GCCGGAGCCCAGGCCCCAGGCGG - Intergenic
902992251 1:20196455-20196477 GCTGAGGCCCAGGCCTCAGCTGG - Intergenic
906483854 1:46219847-46219869 GCGGGAGCCCAGGCCGCTCAAGG + Exonic
910688161 1:89939453-89939475 GCTGAAGCCAAGGGGGCAGAAGG + Intergenic
912514927 1:110211356-110211378 GGGCAAGCCCAAGCCGCAGAGGG + Intronic
915724140 1:158005848-158005870 GCAGAACCCCAGGCTGTAGAGGG + Intronic
918048717 1:180956304-180956326 GCCTGAGCCCAGACTGCAGAAGG - Intergenic
923502379 1:234576306-234576328 GCCAGGGCCCAGGCTGCAGAGGG - Intergenic
923617136 1:235547277-235547299 GCCGCAGCACAGGCCCCAGGGGG - Intergenic
1063364178 10:5479907-5479929 CCCGAAGCCCAGGGCCCTGATGG + Intergenic
1065605587 10:27414214-27414236 GCCCAAGCCCAGGCCGGGGCCGG - Exonic
1067147416 10:43703432-43703454 CCCGAGGCCCAGGCAGCAGCTGG + Intergenic
1068888528 10:62124307-62124329 ACTGAAGCCCAGGCCACTGAGGG - Intergenic
1069650374 10:70042814-70042836 GCTGAGGCCCAGACCCCAGATGG + Intergenic
1072439132 10:95438471-95438493 GCGGAAGCCCAGGCACCAGGTGG - Intronic
1072750498 10:97975227-97975249 GCTCAATCCCAGGTCGCAGAGGG + Intronic
1073196359 10:101694913-101694935 AGGGAAGCCCGGGCCGCAGACGG - Exonic
1077137149 11:1006185-1006207 GCTGTAGCCCAGCCTGCAGACGG + Intronic
1077467154 11:2738789-2738811 GCCAATGCCCAGGTGGCAGAAGG - Intronic
1077956975 11:7031165-7031187 GCCAAAAGCCAGGCCTCAGAAGG - Intronic
1081907141 11:46677358-46677380 GCAGCAGCCCAGGCCCCAGGGGG + Exonic
1085315339 11:75541473-75541495 GCTGGAGCCCAGGCAGCAGATGG - Intergenic
1085318770 11:75562029-75562051 CCCGCAGCCCGGGCCGCCGAGGG + Intergenic
1088437121 11:109826708-109826730 GCTGAAGCCCAGGTCAGAGATGG + Intergenic
1090931678 11:131303216-131303238 GCCCAGGCCCTGGCTGCAGAGGG - Intergenic
1091684585 12:2552664-2552686 GCAGCAGCTCAGGCTGCAGAGGG + Intronic
1092290134 12:7155523-7155545 GGCTAAGCCCAGGCTCCAGAAGG - Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1095891082 12:47235597-47235619 GCCCAAGCTCCGGCGGCAGAAGG + Exonic
1102471673 12:113163033-113163055 GCTGATGCTCAGGCTGCAGAGGG + Exonic
1102531945 12:113553174-113553196 GCAGACGCCCAGGCCGCAATGGG - Intergenic
1102777833 12:115536077-115536099 GCCTGAGCCCAGGAGGCAGAGGG + Intergenic
1103041068 12:117695985-117696007 GCCTCAGCCCAGCCCGCCGATGG - Intronic
1103317221 12:120065745-120065767 CCCGAAGGCTAGGCCACAGAAGG + Intronic
1103521082 12:121537406-121537428 GCCGAGGCCCAGGCGGAAGCCGG - Intronic
1105054755 12:133088045-133088067 GCTGGAGCCCAGGAGGCAGAGGG + Intronic
1105345178 13:19564950-19564972 GCAGAAGCCCAGGCCTCGGCTGG + Intergenic
1106509637 13:30401777-30401799 GCCGAAACCCAGGCAAGAGAAGG + Intergenic
1107601158 13:42013905-42013927 GCCGAAGCACACTCCGCGGAGGG + Intergenic
1107601163 13:42013930-42013952 GCCGAAGCACACTCCGCGGAGGG + Intergenic
1112402304 13:99087051-99087073 GCAGAGGCCCCGGGCGCAGAGGG - Intergenic
1114483261 14:23048088-23048110 GCCGGAGCCCAGGGAGCTGAGGG + Exonic
1117529908 14:56650234-56650256 GCCGAAGTCCAGGCAGAAGTTGG - Intronic
1117754696 14:58961353-58961375 GCTGAAGCCAAGGTCCCAGAGGG + Intergenic
1117974107 14:61280992-61281014 GCCCAGGCCCAGGCCGATGAAGG + Exonic
1119500887 14:75126739-75126761 GCCGCGGCCCAGGACGCGGATGG + Exonic
1121467611 14:94126151-94126173 GCGGCAGCCCAGGCCCCACAAGG - Intergenic
1122921067 14:104880382-104880404 CTCGAACCCCAGGCCGGAGAAGG + Exonic
1123019049 14:105389063-105389085 GCCCAAGCCCAGGCTGCAGTGGG + Intronic
1125514275 15:40309113-40309135 GCAAAAGGCCAGGCCCCAGAGGG - Intergenic
1126009487 15:44288958-44288980 GCAGAAGCCCAGGCCTCGGCTGG - Exonic
1126099665 15:45111706-45111728 CCCGAAGCCCAGGCCCCACCTGG + Intronic
1127803123 15:62494510-62494532 GCAGAAGTTCAGGCCCCAGAGGG + Intronic
1129270683 15:74417818-74417840 GCAGAAGCCCACGCAGTAGAAGG + Intronic
1132120298 15:99169910-99169932 GCAAGAGCCCAGGCCGCAGATGG + Intronic
1132804664 16:1769898-1769920 GCCGACTCCAAGCCCGCAGAGGG + Exonic
1132894779 16:2223656-2223678 GCAGAAGCCCAGGCCGAAGCCGG + Exonic
1133056491 16:3147934-3147956 GCCCAAGCCCAGGCCCTGGAAGG - Intronic
1135754948 16:25089476-25089498 GCCCAAGGCCAGGCCACACAGGG + Intergenic
1136150201 16:28342708-28342730 GCCCAAGCCCAAGAGGCAGAGGG - Exonic
1136166437 16:28456525-28456547 GCCCAAGCCCAAGAGGCAGAGGG - Exonic
1136196536 16:28658507-28658529 GCCCAAGCCCAAGAGGCAGAGGG + Exonic
1136212876 16:28772632-28772654 GCCCAAGCCCAAGAGGCAGAGGG + Exonic
1136257602 16:29052551-29052573 GCCCAAGCCCAAGAGGCAGAGGG + Exonic
1136477864 16:30524655-30524677 GCAGAAGCCCTTGCCGCACACGG + Exonic
1137241454 16:46658159-46658181 GCCAAAGCACTGGCCTCAGAAGG + Exonic
1138336558 16:56258088-56258110 GCCCAAATCCAGGCTGCAGATGG + Intronic
1140123279 16:72101160-72101182 GCGGAAGCACAGGGAGCAGAAGG + Exonic
1140367303 16:74391897-74391919 GCCCAAGCCCAAGAGGCAGAGGG + Exonic
1141686285 16:85571765-85571787 GGCGGAGCTCAGGCTGCAGAGGG + Intergenic
1142232825 16:88907707-88907729 GCAGAGGCCCAAGCCACAGAGGG - Intronic
1142304917 16:89279682-89279704 GCACAAGCTCAGGCCGCAGACGG - Exonic
1143731977 17:8886571-8886593 GCTGAAGCCCAGGCCCTGGAGGG - Exonic
1144828707 17:18120452-18120474 GCCGAAGCCCAGGCCCCGGTGGG - Exonic
1144996192 17:19270825-19270847 GCCGAAGCCCAGGCACCACGGGG - Intronic
1145243584 17:21253261-21253283 GCCGCAGCCCCGCGCGCAGATGG - Exonic
1147564530 17:41528185-41528207 GCCGCCGCCCAGGCCTCCGAAGG + Exonic
1147986063 17:44308502-44308524 GCCGAGGACCAATCCGCAGAGGG - Intronic
1150949685 17:69789181-69789203 GAAGAAGCCCAGGCCACACATGG - Intergenic
1151856622 17:76726541-76726563 GCCGCCGCCCAGGCCGGGGAGGG - Exonic
1152286015 17:79413781-79413803 GCTGCTGGCCAGGCCGCAGAAGG - Intronic
1152924435 17:83080692-83080714 CGCGAAGCCCAGGGCGCCGAGGG + Intronic
1153688470 18:7568154-7568176 GCACTAGCCCAGGCCGCGGAAGG - Intronic
1155906939 18:31462986-31463008 GGAGAAGCCCAGGCAGCAGTGGG + Intronic
1156494969 18:37519699-37519721 GCCAAGGCCCAGGCCACTGAGGG - Intronic
1159241686 18:65750748-65750770 GCCGGAGCCGGGGCCGAAGAGGG - Intronic
1160455375 18:78995422-78995444 GGTGAAGGCCCGGCCGCAGATGG - Exonic
1160510677 18:79451836-79451858 GCCGAAGCCCAGGCCGCAGATGG - Intronic
1160982884 19:1824282-1824304 GCCCAGGCCCAGGCCGCACACGG + Intronic
1161168247 19:2800067-2800089 GCGGAAGCCCAGGCCGGACGGGG + Intronic
1161456810 19:4373739-4373761 GCCTCAGACCAGGCCACAGAGGG + Intronic
1161495611 19:4584357-4584379 GCCGCAGCCCGGGCCGCACTGGG - Intergenic
1161591579 19:5131519-5131541 ACCAAAGCCCGGGCCGGAGAGGG + Exonic
1161679578 19:5673168-5673190 GCTGAAGCCCAGGTCCCAGAGGG + Intergenic
1162566173 19:11446738-11446760 GCCAAGGCCCAGGCTGCAGATGG - Intronic
1163435301 19:17292045-17292067 GCCTGAGCCCAGTCTGCAGATGG + Intergenic
1163592559 19:18202795-18202817 GCCCAAGCCCAGGCAGAAGATGG + Intronic
1164281617 19:23774002-23774024 GCCTAAGACCAGCCCACAGATGG + Intronic
1164312208 19:24056005-24056027 GCCTAAGACCAGCCCACAGATGG + Intronic
1165496256 19:36153639-36153661 GCCTAAACCCAGGAGGCAGAAGG - Intergenic
1166529866 19:43535596-43535618 GCCAAAGGCCTGGCCGCAGCTGG - Exonic
1168108845 19:54180803-54180825 GCCAAAGCCCGGGCCGGAGGCGG - Exonic
1168339862 19:55616677-55616699 GGCGAAGCCCTCGCCGCAGGAGG - Exonic
924998771 2:387009-387031 GCAGAAGCCCAGGACAGAGAAGG - Intergenic
926479688 2:13377155-13377177 GCCGAAGCCAAGACTGAAGAGGG + Intergenic
928340439 2:30438774-30438796 GCCGAAGGCCATGCCTCTGATGG - Intergenic
932265582 2:70364733-70364755 TCCGGAGCCTAGGCCTCAGAAGG - Intergenic
934476349 2:94596109-94596131 GCCGCTGCCCATGCCGCTGACGG - Intronic
937043124 2:118836114-118836136 AGCGCAGCCCAGGCCGCAGGAGG - Intergenic
937069971 2:119055754-119055776 GAGGAAGCCCAGGCCACAGGTGG - Intergenic
944953390 2:204778748-204778770 GCAGAAGTCCAGGCAGGAGATGG - Intronic
946321990 2:218959785-218959807 GCCGGCGCCCAGGCCCCAGCGGG - Exonic
948911938 2:241009278-241009300 GCAGCAGCCCAGGCTGGAGATGG + Intronic
1170627600 20:18041574-18041596 GTTGAAGCCCTTGCCGCAGAAGG + Exonic
1170852575 20:20017878-20017900 GCCGACGGCCAGGCCGCAGAGGG + Intronic
1171246507 20:23614247-23614269 ACCGAAGGCCAGCCTGCAGAAGG - Intergenic
1171411102 20:24949531-24949553 GCTCAAGACCAGGCAGCAGAAGG - Exonic
1172702927 20:36863673-36863695 GCCGGGGCCCGGGCCGCAGCCGG - Exonic
1174454054 20:50637267-50637289 GCCAAAGCACAGGCCTCAGCTGG + Intronic
1179791008 21:43755944-43755966 CCCGCAGCCCAGGCCGGGGAAGG + Exonic
1180061572 21:45388083-45388105 GCCCAGGCCCAGGCTGGAGATGG + Intergenic
1181491416 22:23262845-23262867 AGGGAAGCCCGGGCCGCAGACGG + Intronic
1183071667 22:35400487-35400509 GGCGACGCCCAGGCCGACGAGGG + Exonic
1184564689 22:45285039-45285061 GCCGAACCGCAGGCAGCCGAGGG - Exonic
951476135 3:23108268-23108290 GAGGAAGCCCAAGCCACAGAAGG + Intergenic
960949950 3:122992879-122992901 GCCAAAGCCCAGGCAGCAGCTGG + Intronic
963066704 3:141269933-141269955 GCTCAAGCCCAGGCCACAGGGGG + Intronic
967037321 3:185657547-185657569 GCAGAGCCGCAGGCCGCAGAAGG - Intronic
968465771 4:749898-749920 GCAGGAGCCCAGGAGGCAGAGGG - Intronic
968848640 4:3062514-3062536 GGTGAAGCACAGGCCGCAGAGGG - Intergenic
969715100 4:8864540-8864562 GCCGGAGCTCAGGACTCAGAGGG + Intronic
972335739 4:38106085-38106107 GCCCCAGCCCAGTCCGCAGAGGG - Intronic
972455005 4:39245427-39245449 GCCAAAGCCAAGGAAGCAGATGG + Exonic
976138130 4:81960777-81960799 GAACAAGCCCAGGCAGCAGAAGG + Intronic
979693283 4:123583580-123583602 GCTGGAGCCCAGGAGGCAGAAGG - Intergenic
981049396 4:140295581-140295603 GCCGGAGCCCAGCCAGCAGGCGG - Intronic
985576677 5:676464-676486 TGCAAAGCCAAGGCCGCAGAGGG + Intronic
986169827 5:5306611-5306633 GCCGAAGCCCAGCCTGGAGCTGG + Exonic
986298852 5:6462392-6462414 CCAGAAGCCCAGGCAACAGAGGG + Intronic
986494903 5:8332117-8332139 GCTGAAGACCAGGCCTCAAAAGG + Intergenic
990320308 5:54623441-54623463 GCCTGAGCACAGGCCACAGAGGG + Intergenic
995752960 5:115472793-115472815 GCCGAAGCCAAGGGAGCAGCTGG + Intergenic
998406682 5:141878272-141878294 GCCGCAGCCCAGGCCGGGGCCGG - Exonic
999295928 5:150459389-150459411 GCCGCAGGCCAGCTCGCAGAGGG + Intergenic
1003212334 6:4079097-4079119 GCCGCAGCCCCGGCCCCGGAAGG - Exonic
1003624823 6:7731148-7731170 CCAGCAGCCCAGGCAGCAGACGG - Intronic
1005098735 6:22146693-22146715 GGCGAAGCCCAGGCGGGAGACGG - Intergenic
1006994639 6:38247434-38247456 GCTGAAGACCAGGCAGCAGATGG + Intronic
1007109326 6:39303970-39303992 GCCGAAGCCCACGGTGCTGAGGG + Exonic
1007356045 6:41318631-41318653 GCCAAAGCCCAGGCCACACCCGG + Intergenic
1007732369 6:43954879-43954901 CCAGAAGCCCAGGCTGCAGAGGG - Intergenic
1008013541 6:46491989-46492011 GGCCCAGCCCAGGCCGCTGAGGG + Intergenic
1014892360 6:126858221-126858243 GCTCAAGCCCAGGCTGAAGAAGG + Intergenic
1017811991 6:157990179-157990201 CCCCAGGCCCAGGCCGCAGGAGG + Intronic
1018800658 6:167219690-167219712 GCTGTATCCCAGGCTGCAGAGGG - Intergenic
1018809500 6:167287617-167287639 GCTGTATCCCAGGCTGCAGAGGG + Intronic
1019164605 6:170089738-170089760 GCTCAGGCCCAGACCGCAGAAGG - Intergenic
1019778768 7:2927741-2927763 GCCCAAACCCAGGCCCCAGTGGG + Intronic
1019927769 7:4204689-4204711 GCCGCAGCCCCGGCGGCAGGCGG + Intronic
1020281592 7:6652891-6652913 CCCGAAGCCCGCGCCGCAGAAGG - Exonic
1020281622 7:6653059-6653081 GCGGAAGGCCTGGCCGCAGTCGG - Exonic
1020281896 7:6654097-6654119 GCCGAAGCCCTTGCCGCAGTCGG - Exonic
1020469207 7:8516843-8516865 GCCAATGCCCAGGGTGCAGAAGG + Intronic
1021838862 7:24706304-24706326 GCTGAAGCCCCGGCAGCAGCAGG - Exonic
1032496761 7:132368583-132368605 GCCGCAGCGCAGGCAGCTGAGGG - Intronic
1033401092 7:141026117-141026139 GCTTGAGCCCAGGACGCAGAGGG - Intergenic
1034262464 7:149765407-149765429 GCCGAAGCTCAAGCCGCAGTCGG + Exonic
1034347847 7:150397995-150398017 GCTGAAGCCGCGGCCGCAGGCGG - Exonic
1038117700 8:24576254-24576276 GCAGAAGTCAAGGACGCAGAAGG + Intergenic
1039454388 8:37697645-37697667 GCCCAAGCCCAGCCCGGAGCCGG + Exonic
1048551069 8:135433917-135433939 GAGGAAACCCAGGCCCCAGAAGG + Intergenic
1048801010 8:138193810-138193832 GAGGAATCCCAGGCCCCAGAGGG + Intronic
1049427690 8:142544669-142544691 GCCGAGGCCCAGCGGGCAGATGG + Exonic
1049536763 8:143186127-143186149 CCCGACGCCCAGGCCGGAGCCGG - Intergenic
1049558598 8:143296310-143296332 GCCGAAGGCCTTGCCGCAGTCGG - Exonic
1049588946 8:143446822-143446844 GCCCCAGTCCAGGCCCCAGAGGG - Intronic
1051195459 9:14558863-14558885 GCCGAGGCTCAGGCCCCTGAGGG - Intergenic
1052192668 9:25677667-25677689 GCTGTAGCCGAGGCCGCAGCCGG - Exonic
1052853687 9:33393813-33393835 GCCGCTGCCCACGCCGCTGACGG + Intronic
1053681712 9:40489967-40489989 GCCGCTGCCCATGCCGCTGACGG + Intergenic
1053931706 9:43118297-43118319 GCCGCTGCCCATGCCGCTGACGG + Intergenic
1054282002 9:63134967-63134989 GCCGCTGCCCATGCCGCTGACGG - Intergenic
1054294804 9:63325484-63325506 GCCGCTGCCCATGCCGCTGATGG + Intergenic
1054392824 9:64629971-64629993 GCCGCTGCCCATGCCGCTGATGG + Intergenic
1054427474 9:65135180-65135202 GCCGCTGCCCATGCCGCTGATGG + Intergenic
1054502903 9:65886360-65886382 GCCGCTGCCCATGCCGCTGATGG - Intronic
1058663162 9:107283913-107283935 GCCGAAGGCCTGGTGGCAGATGG + Intronic
1060724652 9:125998993-125999015 GCCGAAATCCAAGCCCCAGAGGG - Intergenic
1061072785 9:128322012-128322034 GCAGAAGCCCATGGTGCAGAGGG + Intronic
1062432320 9:136531700-136531722 GCCGAAGCCCACGCTGCCGGAGG + Intronic
1062579064 9:137221660-137221682 GCCGAAGCGCTGGCTGCAGGAGG + Intergenic
1195485478 X:105400028-105400050 GTAGAATCCCAGGCAGCAGAAGG + Intronic
1195894690 X:109733383-109733405 GCCGAATCGCTGGCTGCAGACGG + Exonic
1199336191 X:146620719-146620741 GCACAAGCTCAGGCCGCAGACGG - Intergenic
1200794992 Y:7332857-7332879 GCTGAAGCCCAGGACGCTGAGGG - Intergenic