ID: 1160510681

View in Genome Browser
Species Human (GRCh38)
Location 18:79451846-79451868
Sequence TCCCACCAGCGCCGAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 133}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160510681_1160510695 30 Left 1160510681 18:79451846-79451868 CCTGGGCTTCGGCGCTGGTGGGA 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1160510695 18:79451899-79451921 CCTGTGCACGGTCACCGGGACGG 0: 1
1: 0
2: 0
3: 7
4: 99
1160510681_1160510684 -4 Left 1160510681 18:79451846-79451868 CCTGGGCTTCGGCGCTGGTGGGA 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1160510684 18:79451865-79451887 GGGAACCGGTTCCCAGTCGGTGG 0: 1
1: 0
2: 0
3: 2
4: 37
1160510681_1160510686 2 Left 1160510681 18:79451846-79451868 CCTGGGCTTCGGCGCTGGTGGGA 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1160510686 18:79451871-79451893 CGGTTCCCAGTCGGTGGAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 89
1160510681_1160510683 -7 Left 1160510681 18:79451846-79451868 CCTGGGCTTCGGCGCTGGTGGGA 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1160510683 18:79451862-79451884 GGTGGGAACCGGTTCCCAGTCGG 0: 1
1: 0
2: 0
3: 8
4: 74
1160510681_1160510689 18 Left 1160510681 18:79451846-79451868 CCTGGGCTTCGGCGCTGGTGGGA 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1160510689 18:79451887-79451909 GAGCAGGACCCACCTGTGCACGG 0: 1
1: 0
2: 1
3: 27
4: 235
1160510681_1160510692 26 Left 1160510681 18:79451846-79451868 CCTGGGCTTCGGCGCTGGTGGGA 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1160510692 18:79451895-79451917 CCCACCTGTGCACGGTCACCGGG 0: 1
1: 0
2: 1
3: 17
4: 134
1160510681_1160510690 25 Left 1160510681 18:79451846-79451868 CCTGGGCTTCGGCGCTGGTGGGA 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1160510690 18:79451894-79451916 ACCCACCTGTGCACGGTCACCGG 0: 1
1: 0
2: 0
3: 1
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160510681 Original CRISPR TCCCACCAGCGCCGAAGCCC AGG (reversed) Intronic
900093965 1:932894-932916 TCCCACCAGCTCAGGGGCCCAGG - Intronic
900162556 1:1231353-1231375 TTCCACCAGAGCTGAAGCCCAGG - Intronic
900936821 1:5771280-5771302 TCTCACCAGCCCCTCAGCCCTGG + Intergenic
901409320 1:9071731-9071753 TCCCTCCAGGGCGGAAGCACGGG - Intronic
903170084 1:21547328-21547350 TCACACTAGCTCCAAAGCCCTGG - Intronic
904200472 1:28816189-28816211 TCCCACCAGACCCTAAGCTCCGG - Intronic
915073680 1:153292467-153292489 TCCCAGCACCCCCGCAGCCCTGG + Intergenic
1064742743 10:18449960-18449982 TCTCACCAGCGTGGAAGACCCGG + Intronic
1065328406 10:24570054-24570076 CCCCACCAACCCCTAAGCCCCGG - Intergenic
1067769830 10:49115345-49115367 CCCCACCAGGCCCGGAGCCCCGG + Intronic
1070490531 10:76971652-76971674 ACCCACCAGGGCCCAAGCTCAGG + Intronic
1070784150 10:79153469-79153491 TCCCACCAGGGCAGATTCCCAGG - Intronic
1076001053 10:126913371-126913393 TGACACCAGCACCAAAGCCCGGG - Intronic
1076044399 10:127279729-127279751 TCCCAACAGAGCTGCAGCCCAGG - Intronic
1077111810 11:865330-865352 TCCCAGCAGCCCTGAGGCCCAGG - Intronic
1077514193 11:2992026-2992048 TCCCGCCAGCGCCCCAGGCCCGG + Intronic
1078035961 11:7805817-7805839 TCCCACAAGCCCTGAAGTCCTGG + Intergenic
1078091675 11:8268199-8268221 TCCCGCCGCCGCCGAAGCCCGGG + Intronic
1079486906 11:20944575-20944597 TTCCACCAGCGCAGAACTCCAGG + Intronic
1083636617 11:64124256-64124278 GCCCTGCAGCTCCGAAGCCCAGG + Intronic
1083791629 11:64989652-64989674 TCCCAGCAGCCCAGGAGCCCTGG + Exonic
1084026810 11:66455795-66455817 TCCTGCCAGCGCCAGAGCCCTGG - Intronic
1086805878 11:91241306-91241328 TCCCACCAGGGCAGAATCCATGG + Intergenic
1088609061 11:111559938-111559960 TCCCTCCCACTCCGAAGCCCTGG + Intronic
1089257812 11:117203205-117203227 GCCCCCCAGCGCCCTAGCCCAGG - Intronic
1092136815 12:6155251-6155273 TCCCACCAGAGCGGAAGAACAGG + Intergenic
1094061297 12:26317493-26317515 TCAGAGCAGTGCCGAAGCCCAGG + Intergenic
1094411168 12:30170068-30170090 TGCCAGCAGCGCCGCGGCCCCGG + Intergenic
1096554455 12:52394895-52394917 TCCCACCAGGGCTGAAGACAAGG - Exonic
1102222488 12:111203962-111203984 TGCCACCAGCCCTGAGGCCCTGG - Intronic
1102223384 12:111210040-111210062 CCCCACCAGCCCCCCAGCCCTGG - Intronic
1104265908 12:127232250-127232272 ACCCACCACCCTCGAAGCCCTGG - Intergenic
1113416072 13:110129700-110129722 TGCCCCCAGCGCAGCAGCCCGGG + Intergenic
1113542983 13:111123253-111123275 CCCCACCAGCACCCAAGCCCTGG - Intronic
1113679016 13:112229380-112229402 TCCCTCCAAGGCAGAAGCCCAGG - Intergenic
1115576137 14:34714306-34714328 CCCAACCTGCGCCGACGCCCGGG + Intronic
1122122484 14:99561850-99561872 TCTCACCAACGCCGTAGCGCAGG - Intronic
1122923061 14:104887863-104887885 GCCCACCATGGCCGAAGCACGGG + Exonic
1122993274 14:105248891-105248913 TCCCGCCAGCGCCGCGGCCGCGG + Exonic
1127535531 15:59886599-59886621 TCCCACCAGGGCTGAAAGCCAGG - Intergenic
1127849857 15:62902918-62902940 TCCCACAAGGGCCCAAGCTCTGG - Intergenic
1129244092 15:74269319-74269341 TCCCACCAGCACCGTGGGCCTGG + Intronic
1129466933 15:75729440-75729462 TCCCACCCGCCCCCAGGCCCTGG + Intergenic
1129720303 15:77874311-77874333 TCCCACCTGCCCCCAGGCCCTGG - Intergenic
1130540396 15:84817476-84817498 GCCCACCCGCGCCCCAGCCCCGG - Exonic
1131174382 15:90201091-90201113 TCCCACCGCCGCCCAGGCCCTGG - Intronic
1131833668 15:96369720-96369742 TCTTACCGGCGCCGACGCCCTGG - Intergenic
1132657020 16:1045701-1045723 CTGCACCAGCACCGAAGCCCAGG + Intergenic
1132731976 16:1367168-1367190 TCCCCACAGCCCCGCAGCCCCGG + Intronic
1132884282 16:2175747-2175769 GCCCAGCAGTGCTGAAGCCCTGG + Intronic
1133239879 16:4408039-4408061 TCAGACCAGCCCCGCAGCCCTGG + Intronic
1139678118 16:68539387-68539409 TCCCGCCCCCGCCGAAGCCTCGG - Exonic
1140995203 16:80252394-80252416 TCCCACCAACCCAGAAGACCTGG + Intergenic
1141167107 16:81668305-81668327 TCCCAGCACCTCCGCAGCCCTGG + Intronic
1143931651 17:10435301-10435323 CACCACCAGCTCCAAAGCCCTGG - Intergenic
1144854153 17:18258732-18258754 TCCCCCCAGCGCCCTCGCCCCGG - Exonic
1146167543 17:30601239-30601261 GCCCACCTGGGCCGTAGCCCAGG - Intergenic
1146219950 17:31009125-31009147 TCCCACCTGGGCGGTAGCCCAGG - Intergenic
1147914787 17:43879811-43879833 TCCCAGCAGCGACCACGCCCCGG + Exonic
1148163514 17:45465821-45465843 TCCCACCAGCTTTGAGGCCCTGG + Intronic
1150394741 17:64812473-64812495 TCCCACCAGCTTTGAGGCCCTGG + Intergenic
1151448099 17:74180520-74180542 TCCCATCAGCCCCCAGGCCCAGG + Intergenic
1151497206 17:74466179-74466201 TTCCCTCAGCCCCGAAGCCCAGG + Intergenic
1152299102 17:79485086-79485108 TCCCACCAGCCCCAAAGCAGAGG + Intronic
1156934271 18:42683770-42683792 TCCCAACAACAACGAAGCCCAGG + Intergenic
1157621753 18:49020987-49021009 TCCCACCAGCTCCGAAACAGAGG - Intergenic
1158543682 18:58378477-58378499 TCCCAGGAGCGCTGAGGCCCCGG + Intronic
1160510681 18:79451846-79451868 TCCCACCAGCGCCGAAGCCCAGG - Intronic
1160580627 18:79882940-79882962 GCACACCAGCGCCCACGCCCAGG + Intronic
1160686927 19:441239-441261 TTCCACCAGCACCGAAGCCGAGG + Intronic
1160851560 19:1195307-1195329 TCCCCCCGGCTCCGATGCCCAGG - Intronic
1160851984 19:1197121-1197143 TCCCCCCGGCTCCGATGCCCAGG - Intronic
1161801782 19:6420336-6420358 TCCTGCCAGCCCAGAAGCCCTGG - Intronic
1165068916 19:33244013-33244035 TGCCACCAGCACAAAAGCCCTGG - Intergenic
1166197939 19:41219126-41219148 GCCCACCAGGGCCAGAGCCCAGG - Intergenic
1166317985 19:41999211-41999233 TCCCGCCGGCGCCGACGCCCGGG - Exonic
927215488 2:20666163-20666185 GCCCGGCAGCGGCGAAGCCCTGG - Intergenic
931940551 2:67247267-67247289 TCCCACCAGCCCCCAACCCTAGG + Intergenic
932496756 2:72149406-72149428 TCCCTCCTGGGCCGAAGCCCCGG + Intergenic
935820353 2:106887140-106887162 CCCCGCCAGCGCGGAAGGCCGGG + Intergenic
944483868 2:200182769-200182791 TCTCACCAGAGAGGAAGCCCTGG - Intergenic
946248931 2:218401584-218401606 TCCCAGAAGCCCCGAAGCCGGGG + Exonic
946410849 2:219514529-219514551 TCCCAGCAGCTCCGCAGCCCTGG - Exonic
946688081 2:222291335-222291357 TCCCTCCAGCTCCATAGCCCAGG - Intronic
948619773 2:239227139-239227161 TCCCACCAGCCCCTGTGCCCCGG - Intronic
1175964555 20:62654060-62654082 TCCCACCAGCTCCGGAGGCCAGG + Intronic
1176871232 21:14084506-14084528 GCCCACCCGCCCCGGAGCCCCGG - Intergenic
1180612709 22:17108331-17108353 TCCCCCCACCGCTGAAGCCCAGG + Exonic
1181299338 22:21868030-21868052 TCCCGGCAGCGCCGCAGCTCAGG + Intergenic
1181517120 22:23421216-23421238 TCCAACCAGCTCCGAGGCCGTGG + Intergenic
1181524231 22:23470091-23470113 TCCCACCCCAGCTGAAGCCCGGG + Intergenic
1183094220 22:35542470-35542492 TCTCACCAGCCCGGCAGCCCTGG - Intronic
1183658412 22:39204379-39204401 TCCCACCATCCCCGCAGCCATGG + Intergenic
950043323 3:9933795-9933817 CCCCACCCGCGCCGCAGTCCAGG - Intergenic
954111727 3:48437364-48437386 TCCCACCAGCCCCCAACCCTGGG + Intronic
954200310 3:49020119-49020141 TCCCAGCAGGGCCTCAGCCCTGG - Intronic
955753191 3:62203349-62203371 TGCCACCACCGCCGAACCCCAGG - Exonic
956886338 3:73564006-73564028 TCACAGCAGCCCAGAAGCCCAGG - Intronic
957732687 3:84161822-84161844 TCCCCCCGGCCCCCAAGCCCTGG + Intergenic
960284562 3:115812538-115812560 TCCTACCAGCCCAAAAGCCCTGG - Intronic
961431752 3:126888852-126888874 TCTCCCCAGAGCGGAAGCCCAGG - Intronic
961450342 3:126999675-126999697 TCCCATCACCGCCACAGCCCTGG - Intronic
966520675 3:180870259-180870281 TCACAGCAGCGTCCAAGCCCTGG + Intronic
974818177 4:67032991-67033013 TCCCAGCAGCACCGAGCCCCTGG - Intergenic
975801337 4:78061507-78061529 TCCCACAAACGCTGAATCCCGGG + Intronic
983196718 4:164814803-164814825 TACCACCACCGCCTGAGCCCCGG + Intergenic
986152565 5:5140555-5140577 TCCCACCAGCGCGGAAACCGCGG + Intronic
998092564 5:139379896-139379918 TCCCACCTCAGCCCAAGCCCTGG + Intronic
998150776 5:139756332-139756354 TCCCTCCAGCGCCGCGGCCCCGG - Intergenic
1001525561 5:172426283-172426305 TCTCACCAGCCCCCAAACCCAGG - Intronic
1002043520 5:176530249-176530271 TCCCAGCCGCCCCGGAGCCCAGG + Intronic
1002043537 5:176530297-176530319 TCCCAGCCGCCCCGGAGCCCAGG + Intronic
1002043570 5:176530393-176530415 TCCCAGCCGCCCCGGAGCCCAGG + Intronic
1003303211 6:4903579-4903601 TCCCTCCGGCACCCAAGCCCTGG - Intronic
1004494133 6:16147496-16147518 TTCCACCAGCTCAGAAGGCCCGG - Intronic
1005623987 6:27646241-27646263 TGCCACCTGCGCCTCAGCCCAGG + Intergenic
1005881010 6:30061027-30061049 TCCCACCAGCACCCAATCCTGGG - Intronic
1019397575 7:830292-830314 CCTGACAAGCGCCGAAGCCCAGG - Intronic
1019449326 7:1088669-1088691 TCTCACCAACCCTGAAGCCCTGG + Intronic
1022418374 7:30197662-30197684 TGCCACCAGTGCAGAAGGCCAGG - Intergenic
1024563104 7:50660836-50660858 TCCCGCCAGGGCCAAGGCCCTGG + Intronic
1026486833 7:70829244-70829266 TCACACCATCGCCCAAGCCTTGG - Intergenic
1026911218 7:74093016-74093038 CCCCACCCGCACCAAAGCCCAGG + Intronic
1027170286 7:75866879-75866901 TCCCTCCAGCCCCCAACCCCGGG - Intronic
1030127445 7:106168146-106168168 TCCCACCAGGGCCCAGGGCCAGG - Intergenic
1032192244 7:129771795-129771817 CCTCCCCAGCGCCCAAGCCCAGG - Intergenic
1033355729 7:140597853-140597875 TCCAGCCAGTGCCAAAGCCCGGG - Intronic
1034421661 7:150993940-150993962 TCCCACCAGCGCCAGAACACAGG + Exonic
1035656190 8:1307850-1307872 TCCCTCCAGCGCCCAGTCCCCGG - Intergenic
1041095324 8:54343708-54343730 TCCCACCAGAGCTGGAACCCAGG + Intergenic
1043473528 8:80584102-80584124 TGACACCAGCTCCGGAGCCCAGG - Intergenic
1046932505 8:119855690-119855712 TGGCCCCAGGGCCGAAGCCCAGG + Exonic
1049587447 8:143438622-143438644 TCCCCACAGCGGGGAAGCCCAGG + Intronic
1049780806 8:144428043-144428065 GGCCGCCCGCGCCGAAGCCCTGG + Intronic
1052678776 9:31661199-31661221 TCTGACCTGCCCCGAAGCCCAGG + Intergenic
1053061611 9:35036359-35036381 TCCCACAAGCCCGAAAGCCCGGG + Intergenic
1053397038 9:37784818-37784840 TCCCCACAGCGCCGAAGGCCCGG + Exonic
1054787475 9:69222759-69222781 TCCCACCAGCTCAGAAACCATGG + Intronic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1056683893 9:88743864-88743886 TCCCACTAACAGCGAAGCCCAGG - Intergenic
1057035826 9:91811163-91811185 CCCCACCAGCGCCGCTGTCCCGG - Intronic
1057282083 9:93720393-93720415 TCCCAGCAGAGCCCAAGCTCTGG + Intergenic
1060101244 9:120842880-120842902 TCTCAGCAGCGCCAAAGCCTGGG + Exonic
1061369693 9:130191452-130191474 TCCCACCAGCCCGGAGGCTCTGG + Intronic
1187484959 X:19694538-19694560 TCCCTCCAGTGCCAAAGCCTGGG - Intronic
1194550035 X:95286251-95286273 TACCACCAGCTCAAAAGCCCTGG + Intergenic
1197674435 X:129314272-129314294 TTCCACCACCACCCAAGCCCTGG + Intergenic
1198242801 X:134801624-134801646 TGCCATCAGTGCAGAAGCCCAGG - Intronic