ID: 1160510934

View in Genome Browser
Species Human (GRCh38)
Location 18:79452906-79452928
Sequence GAGGCATTCAGCCTTGATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160510932_1160510934 -10 Left 1160510932 18:79452893-79452915 CCTGGAAACCGCGGAGGCATTCA 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1160510934 18:79452906-79452928 GAGGCATTCAGCCTTGATAATGG 0: 1
1: 0
2: 0
3: 13
4: 105
1160510931_1160510934 -9 Left 1160510931 18:79452892-79452914 CCCTGGAAACCGCGGAGGCATTC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1160510934 18:79452906-79452928 GAGGCATTCAGCCTTGATAATGG 0: 1
1: 0
2: 0
3: 13
4: 105
1160510926_1160510934 22 Left 1160510926 18:79452861-79452883 CCAATTGGAATTCTTTTGCACTT 0: 1
1: 0
2: 2
3: 24
4: 281
Right 1160510934 18:79452906-79452928 GAGGCATTCAGCCTTGATAATGG 0: 1
1: 0
2: 0
3: 13
4: 105
1160510929_1160510934 -4 Left 1160510929 18:79452887-79452909 CCAATCCCTGGAAACCGCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1160510934 18:79452906-79452928 GAGGCATTCAGCCTTGATAATGG 0: 1
1: 0
2: 0
3: 13
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160510934 Original CRISPR GAGGCATTCAGCCTTGATAA TGG Intronic
902661893 1:17910038-17910060 CAGGCATTCAGCCTTGTCAATGG - Intergenic
907307101 1:53519583-53519605 TAGGCATCCAGCCCAGATAAGGG - Intronic
909187958 1:72513527-72513549 GAGGCATGGAGCTTTGATAATGG - Intergenic
916389104 1:164310930-164310952 GAGAAATTCAGCCTTGAAAAAGG + Intergenic
916768048 1:167880790-167880812 GAGGGCTTGAGCCTTGAGAAGGG + Intronic
918615145 1:186535591-186535613 CAGGCAGTGAGCCTTGCTAAAGG + Intergenic
921734445 1:218611091-218611113 AAGGTAATCAGGCTTGATAATGG + Intergenic
922407695 1:225333429-225333451 GAGACATTCTGCATTGAAAATGG + Intronic
923411390 1:233713460-233713482 GCTGCATGCAGCATTGATAAAGG + Intergenic
1065182381 10:23139629-23139651 GAGGCAGTGAATCTTGATAAGGG + Intergenic
1065208179 10:23376673-23376695 GAGGCATTTGGCCTTCAGAAGGG + Intergenic
1065828985 10:29597328-29597350 GAGGCATTTACCCTTGATCCTGG - Intronic
1065872044 10:29964032-29964054 GTGTCATTCAGCCTGGAGAATGG - Intergenic
1073723865 10:106207245-106207267 GAGATGTTCAGCCTTGATAAAGG - Intergenic
1073951165 10:108811516-108811538 GAAGCATTCAGCATGGAAAAAGG + Intergenic
1076084670 10:127616004-127616026 GAGGCCTTCACACTTGTTAATGG - Intergenic
1076333491 10:129689447-129689469 AAGGCATTCAGTCTTGAACATGG + Intronic
1080858246 11:36130662-36130684 GAGTCATTCAGGCTTCATCAAGG + Intronic
1089180196 11:116578329-116578351 CAGGCATTCAGCTTTGATTCTGG + Intergenic
1092629824 12:10365235-10365257 GGGGCAATTAGCCTTGGTAAGGG - Intergenic
1092742022 12:11639298-11639320 GAGGGCTTCAGGGTTGATAAAGG + Intergenic
1094622429 12:32092810-32092832 ATAGCATTCAGCATTGATAAAGG + Intergenic
1095629690 12:44360751-44360773 GAGGCATACAGCCTTAACCATGG + Intronic
1098115171 12:67167757-67167779 TAGGCATTCAGACTTAAAAAAGG + Intergenic
1098133674 12:67378800-67378822 GAGGAATTGAGCCATGATATAGG - Intergenic
1100615048 12:96224766-96224788 AAGGCATAGAGCCATGATAATGG + Intronic
1101802062 12:108031129-108031151 GTGGCTTTCAGAGTTGATAAAGG - Intergenic
1104079128 12:125414999-125415021 GTGGCATTCAGGCAGGATAACGG - Intronic
1107109825 13:36684796-36684818 GAAGAGCTCAGCCTTGATAAAGG + Intronic
1109979659 13:69890486-69890508 GAGCTATTCAGCAGTGATAAGGG - Intronic
1110333936 13:74304162-74304184 CAGGCTTTCAGCCTTGACCAAGG + Intergenic
1110766742 13:79288552-79288574 CAGGCATCCAGCCTTCTTAATGG + Intergenic
1113042619 13:106120988-106121010 GAAGCACCCAGCCTTGACAATGG - Intergenic
1114810223 14:25890440-25890462 GAGGCATTCAGCTATCCTAATGG - Intergenic
1115096997 14:29649263-29649285 GAGGCAGGTAGCCTTGGTAAAGG + Intronic
1117866637 14:60156560-60156582 GAGGCATTCAGATTAGATGATGG + Intronic
1118584103 14:67335664-67335686 CAGGGATTTAGCCTTAATAAAGG + Exonic
1121305809 14:92906372-92906394 GAGGCCTTGAGCCTTGAGAGTGG - Intergenic
1122319652 14:100846086-100846108 GAGACACTCAGCCATGTTAATGG + Intergenic
1125749367 15:42018488-42018510 CAGGCATTCATCCTTCATGAGGG + Intronic
1125761274 15:42097214-42097236 GAGGCAGTCAGCCTGGAACAGGG + Intergenic
1127446617 15:59069639-59069661 CAGGCATTCAGTGGTGATAATGG + Intronic
1130660887 15:85830760-85830782 GAGGAAATCAGACTTGATCAGGG + Intergenic
1135227752 16:20676061-20676083 GGGGCAGTTAGCCTTGGTAAAGG - Intronic
1142139128 16:88464813-88464835 GTGAGATACAGCCTTGATAATGG + Intronic
1145974888 17:28978216-28978238 GAGGCATTCAGCCTGGTTGAGGG - Intronic
1149077401 17:52612502-52612524 GAGTCATTCCACCTTGGTAATGG + Intergenic
1149952314 17:61002835-61002857 GAGGCATTGAGGCATTATAAGGG + Intronic
1150502377 17:65663669-65663691 TAGGCATTCAGCATTGTTCAGGG - Intronic
1151867307 17:76812569-76812591 GAGGCACTCAGAATTGAAAAGGG + Intergenic
1154006137 18:10528704-10528726 GAGGCCTTCAGCCAAGATAGGGG + Intronic
1155872951 18:31049787-31049809 GTGGCATTCAGCCTTGAAGATGG - Intergenic
1159367531 18:67488274-67488296 GAGGCAAACAGCTTTGATCACGG + Intergenic
1160510934 18:79452906-79452928 GAGGCATTCAGCCTTGATAATGG + Intronic
1163335633 19:16669835-16669857 GAGGCATTGACCCCTGAAAAGGG + Intronic
1164053720 19:21604720-21604742 GGGGCAGTTAGCCTTGGTAAAGG - Intergenic
1165505898 19:36229199-36229221 GAGGCATTCAGCCACTAGAAAGG - Intronic
925424202 2:3735187-3735209 GAGGCATTCAGCGTGCAGAAGGG + Intronic
927824678 2:26299858-26299880 GGGGCAGTTAGCCTTGGTAAAGG - Intergenic
932438037 2:71714527-71714549 TTGTCATTCAGCCTTGCTAAAGG - Intergenic
933171273 2:79128665-79128687 ACAGCATTCAGCCTTCATAATGG + Intergenic
935131872 2:100266631-100266653 GCTGCATACAGCCTTGATCAAGG - Intergenic
936645619 2:114366525-114366547 GAGACCTTCTGCCTTAATAAAGG - Intergenic
939692461 2:145281491-145281513 GAGGCATTACGTATTGATAAAGG + Intergenic
940365445 2:152843713-152843735 GAGGCACTCAACCTAGATCAAGG - Intergenic
946342279 2:219078175-219078197 GAGGCATGCAGCATTGGTGATGG - Exonic
1170326263 20:15157448-15157470 CAGGCATTCAGCCATAAAAATGG + Intronic
1170441710 20:16386072-16386094 CATACCTTCAGCCTTGATAAGGG - Intronic
1174422261 20:50407103-50407125 GTGGCATTCATCCTTAACAAGGG + Intergenic
1175784367 20:61703291-61703313 GAGGCATTCATCCTAGTTTAAGG + Intronic
1175954031 20:62599144-62599166 CAGGCAGTCACCCTTGATGAAGG - Intergenic
1178276067 21:31238194-31238216 CAGGCAATCAGCCATGATTATGG - Intronic
1179044453 21:37832016-37832038 GAGGCATACTTCCTTTATAAAGG - Intronic
1182146338 22:27999030-27999052 GACGCATTCAGCCTGGGTCAGGG + Exonic
949809589 3:7991884-7991906 AAGGCATTTTGCCTTAATAAGGG - Intergenic
952464029 3:33561763-33561785 AAGAGATACAGCCTTGATAAAGG - Intronic
957869249 3:86066722-86066744 GCTGCCTTCAGCATTGATAATGG - Exonic
958608736 3:96395582-96395604 GAGGAAATCAGCCTTGATACTGG - Intergenic
958703011 3:97617116-97617138 GGGGCATTCAACATTGTTAAAGG + Intronic
959558828 3:107755854-107755876 GAGTCATTAAGCATTGCTAAAGG + Intronic
961091486 3:124116475-124116497 AAGTCATTCAGCCTGGATAATGG + Intronic
971808403 4:31391147-31391169 CAGGCCTACAGCCTTCATAAAGG + Intergenic
974529002 4:63082561-63082583 GAGGCATTCAGACTTGAACTGGG - Intergenic
977475800 4:97507659-97507681 GATTCACTCAGGCTTGATAAGGG + Intronic
983658572 4:170108602-170108624 AAGGCCTTCAGCCTAGAAAAGGG + Intergenic
987198529 5:15551329-15551351 GAGGCTTTCTGCCTTGAAAGGGG - Intronic
991316105 5:65308747-65308769 TATTCATTCAGCCTTGATGATGG - Intronic
993388981 5:87295073-87295095 GAGGCATTAAGTAATGATAAAGG - Intronic
996601821 5:125273177-125273199 GAGGCATTCAGCCTTGTAACTGG + Intergenic
997440032 5:133902659-133902681 GAGGCATTCAGACTGGAGGAGGG + Intergenic
1002560222 5:180076661-180076683 GAGGCATGCAGGCTTCATAACGG - Intergenic
1002566580 5:180115625-180115647 GAGGCACGCAGGCTTGATAAAGG - Intronic
1004152149 6:13131715-13131737 GTGGCATTCTGCTTTGAAAATGG + Intronic
1009321910 6:62301850-62301872 AAGGCATTATGCTTTGATAATGG - Intergenic
1012270242 6:97200420-97200442 GAGGCTCTCAGCCCTAATAATGG - Intronic
1014509972 6:122308574-122308596 GAGACATTCAGCTTTGATGTTGG + Intergenic
1014983361 6:127972686-127972708 TAGACATACAGCCTTGATATAGG + Intronic
1018869651 6:167771025-167771047 GAGGCATGCAGCATTAATGAGGG - Intergenic
1022438481 7:30412603-30412625 CAGGTATTCAGCCTTGGAAATGG + Intergenic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1034103982 7:148475020-148475042 GATGCATTCAGCTCTGATAAAGG + Intergenic
1034313444 7:150110183-150110205 GAGGCATTCAGCGTGGATGTGGG - Intergenic
1034793416 7:153990481-153990503 GAGGCATTCAGCGTGGATGTGGG + Intronic
1038228750 8:25681354-25681376 GAGGGATTAAGCCTGAATAAAGG + Intergenic
1039437055 8:37566931-37566953 GAGGCTGTCAGCCTAGAGAAGGG + Intergenic
1045875864 8:106979930-106979952 GAGGCATTTAACCTTGATACTGG + Intergenic
1048176036 8:132153743-132153765 GAGGCTTTCACCCATGTTAATGG - Intronic
1051225775 9:14897650-14897672 GTGGCAGTGAGCCTTGATGAAGG - Intronic
1053308734 9:37002143-37002165 AAGGCCTTCAGCCCTGATGATGG - Intronic
1055241604 9:74192908-74192930 CAGGCAGTCAGCCTTCAAAAGGG - Intergenic
1055459649 9:76506711-76506733 CAGCCACTCAGCCTTGAAAATGG + Exonic
1057537586 9:95929042-95929064 GAGGAATTCAATGTTGATAAAGG - Intronic
1061021180 9:128015965-128015987 GAGGCAGTCAGCCTTCAGGATGG + Intergenic
1193045903 X:77053910-77053932 GTATCATTCAGCCTTAATAAAGG + Intergenic
1193099742 X:77595572-77595594 AAGGGATTCAGCTTTGAGAAGGG + Intronic
1193867198 X:86748600-86748622 GAGCCATGAAGCCTGGATAATGG - Intronic
1199670570 X:150144753-150144775 GAGGCTTTCACTTTTGATAATGG - Intergenic
1201112291 Y:10808344-10808366 GAGACATTCAGTCGAGATAAAGG - Intergenic
1201572026 Y:15424918-15424940 GGGGCAGTTAGCCTTGGTAAAGG - Intergenic