ID: 1160511013

View in Genome Browser
Species Human (GRCh38)
Location 18:79453392-79453414
Sequence GTGCCACGGCGCCATGGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 46}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160511004_1160511013 14 Left 1160511004 18:79453355-79453377 CCAGCTCCTGCCCTAGCCAAGTT 0: 1
1: 0
2: 1
3: 17
4: 250
Right 1160511013 18:79453392-79453414 GTGCCACGGCGCCATGGGTAAGG 0: 1
1: 0
2: 0
3: 5
4: 46
1160511003_1160511013 15 Left 1160511003 18:79453354-79453376 CCCAGCTCCTGCCCTAGCCAAGT 0: 1
1: 0
2: 1
3: 34
4: 283
Right 1160511013 18:79453392-79453414 GTGCCACGGCGCCATGGGTAAGG 0: 1
1: 0
2: 0
3: 5
4: 46
1160511005_1160511013 8 Left 1160511005 18:79453361-79453383 CCTGCCCTAGCCAAGTTACTGTG 0: 1
1: 0
2: 2
3: 9
4: 165
Right 1160511013 18:79453392-79453414 GTGCCACGGCGCCATGGGTAAGG 0: 1
1: 0
2: 0
3: 5
4: 46
1160511009_1160511013 -2 Left 1160511009 18:79453371-79453393 CCAAGTTACTGTGCTGAGTTGGT 0: 1
1: 0
2: 2
3: 3
4: 122
Right 1160511013 18:79453392-79453414 GTGCCACGGCGCCATGGGTAAGG 0: 1
1: 0
2: 0
3: 5
4: 46
1160511007_1160511013 3 Left 1160511007 18:79453366-79453388 CCTAGCCAAGTTACTGTGCTGAG 0: 1
1: 0
2: 1
3: 11
4: 119
Right 1160511013 18:79453392-79453414 GTGCCACGGCGCCATGGGTAAGG 0: 1
1: 0
2: 0
3: 5
4: 46
1160511002_1160511013 16 Left 1160511002 18:79453353-79453375 CCCCAGCTCCTGCCCTAGCCAAG 0: 1
1: 0
2: 1
3: 61
4: 466
Right 1160511013 18:79453392-79453414 GTGCCACGGCGCCATGGGTAAGG 0: 1
1: 0
2: 0
3: 5
4: 46
1160511001_1160511013 27 Left 1160511001 18:79453342-79453364 CCGCAGAGGTGCCCCAGCTCCTG 0: 1
1: 0
2: 3
3: 46
4: 410
Right 1160511013 18:79453392-79453414 GTGCCACGGCGCCATGGGTAAGG 0: 1
1: 0
2: 0
3: 5
4: 46
1160511006_1160511013 4 Left 1160511006 18:79453365-79453387 CCCTAGCCAAGTTACTGTGCTGA 0: 1
1: 0
2: 1
3: 15
4: 152
Right 1160511013 18:79453392-79453414 GTGCCACGGCGCCATGGGTAAGG 0: 1
1: 0
2: 0
3: 5
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160511013 Original CRISPR GTGCCACGGCGCCATGGGTA AGG Intronic
900264196 1:1749192-1749214 GTGCCAAGGCCCCATGGGTGGGG + Intergenic
921128104 1:212195874-212195896 GTGCCACTGTGCCCTGGGTGTGG + Intergenic
921763881 1:218947854-218947876 GGGCCACAGCTCCATGGGCACGG - Intergenic
1064633313 10:17339300-17339322 GTGCCTGGGAGCCATGGGTTTGG - Intronic
1070851851 10:79570735-79570757 GTGGCAAGGCTCCATGGGCATGG - Intergenic
1074573344 10:114645132-114645154 GTGCCACGGAGGTATGGGTAGGG - Intronic
1078251181 11:9617724-9617746 GAGCCACAGCGCCCTGGGGACGG + Intergenic
1079413573 11:20212140-20212162 GTGCCACAGCACATTGGGTAAGG + Intergenic
1083318958 11:61833664-61833686 GAGCCACGGGGCCATGGGAGTGG - Intronic
1085346138 11:75769117-75769139 GTGCCACGGCGCAGGGGTTATGG + Intronic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1095983065 12:47983623-47983645 GTCCCAGGGAGCCCTGGGTATGG + Intronic
1099328699 12:81253312-81253334 CTGCCACGGTACCATGGGAAAGG - Exonic
1100140735 12:91615984-91616006 GAGCCACGCCGCCATGGAGAAGG + Intergenic
1103327494 12:120131179-120131201 GTGCCACGGCGGACAGGGTAAGG - Exonic
1123114052 14:105885909-105885931 AGGACACGGCGCCATGGGTATGG - Intergenic
1123116275 14:105895527-105895549 AGGACACAGCGCCATGGGTATGG - Intergenic
1145994683 17:29098543-29098565 GGGCCAGGACGCCATGGGGAAGG + Intronic
1146689111 17:34860919-34860941 GTGCCAAGGGGACATGGGCAAGG + Intergenic
1150008212 17:61482771-61482793 GTGCCATGGCAACATGGGGAGGG + Intronic
1150635016 17:66906810-66906832 GTGGCACGGAGCCATGGTCAAGG + Intergenic
1160511013 18:79453392-79453414 GTGCCACGGCGCCATGGGTAAGG + Intronic
1160588896 18:79928808-79928830 CTGCCCCTGCGCCATGGGTGGGG - Intronic
1162953402 19:14085255-14085277 GTCCCAGGTCCCCATGGGTAAGG - Intronic
1167661073 19:50796474-50796496 GTGCCACACAGCCATGGGTGTGG - Intergenic
1167959869 19:53097027-53097049 GGGCCACGGGGCCCTGGGAAGGG - Intronic
1167963668 19:53126868-53126890 GGGCCACGGGGCCCTGGGAAGGG - Intronic
929158777 2:38811311-38811333 GTCCCACAGTGCCATGGGAAAGG - Intronic
1172188729 20:33048920-33048942 CTGCCAGGGCCCCATGGCTAGGG - Intergenic
1179641065 21:42747491-42747513 GGGCCTCGGAGCCAGGGGTATGG + Intronic
1183665054 22:39242358-39242380 GTGCCAGGGCGTCCTGGGAACGG - Intronic
952953377 3:38542099-38542121 GAGCCACAGAGCCAGGGGTAGGG - Intronic
954972670 3:54664248-54664270 GTGTCCCCGTGCCATGGGTAAGG + Intronic
961745061 3:129059430-129059452 ATGCCAAGGCTCCATGGGGAGGG + Intergenic
963247601 3:143077036-143077058 GTGCCCCGGCTCCCAGGGTAGGG - Intergenic
968876444 4:3270238-3270260 GTGCCCCGGCTCCCTGGGCACGG - Intronic
969396439 4:6924680-6924702 GTGACAAGGCCCCATGGGGACGG - Intronic
971266006 4:25096601-25096623 TTCCCACGGCGGCAGGGGTACGG + Intergenic
973792968 4:54395170-54395192 GTGCCTCAGAGCCATGGGTAAGG + Intergenic
985100144 4:186450756-186450778 GTACCACGGCTCCATGGTCACGG + Intronic
997521505 5:134526777-134526799 GAGCCTCGGCGCCAGGGGTGAGG + Intronic
997818357 5:137039602-137039624 GTCCCACGCCCCCATGGGCAGGG + Intronic
1000551109 5:162665724-162665746 GTCCCACTGGGCCTTGGGTACGG + Intergenic
1003224045 6:4188961-4188983 GTGCCAGGGCGCAGTGGGAAGGG + Intergenic
1005360197 6:25024127-25024149 GTCCCGCGGCGCCACCGGTAAGG - Intronic
1007414726 6:41684767-41684789 ATGCCCCGGCGCCAGGGGTTCGG + Exonic
1015837417 6:137435722-137435744 GTGGCCCGGCGCCATGGCTCAGG + Intergenic
1055626053 9:78178603-78178625 GTCCCACGGTGCCACGGGAAAGG + Intergenic
1060495949 9:124118644-124118666 GAGCCACAGCCCCATGGGGAAGG - Intergenic
1061418025 9:130458568-130458590 GTCCCACGGCGCCACAGGAAAGG + Exonic
1062473654 9:136717442-136717464 GTGCCAGGGGGCCAAGGGGATGG + Intronic
1193569225 X:83121640-83121662 GTGCCATGGTACCATGGGTATGG + Intergenic