ID: 1160511114

View in Genome Browser
Species Human (GRCh38)
Location 18:79454077-79454099
Sequence CTGCTCTTGCAGATGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160511110_1160511114 29 Left 1160511110 18:79454025-79454047 CCCTCTCGTTTTCTGATGGGATC 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1160511114 18:79454077-79454099 CTGCTCTTGCAGATGGAACCAGG 0: 1
1: 0
2: 1
3: 11
4: 164
1160511111_1160511114 28 Left 1160511111 18:79454026-79454048 CCTCTCGTTTTCTGATGGGATCG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1160511114 18:79454077-79454099 CTGCTCTTGCAGATGGAACCAGG 0: 1
1: 0
2: 1
3: 11
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160511114 Original CRISPR CTGCTCTTGCAGATGGAACC AGG Intronic
900922534 1:5682586-5682608 CTGTACTTGCAGACGCAACCTGG - Intergenic
901162757 1:7192598-7192620 CTGCTCCTGCAGGTGGCACTCGG - Intronic
902221549 1:14969095-14969117 CTGCCTTTGCAGATGTCACCAGG + Intronic
904407921 1:30305737-30305759 CTGATCTTCCACATGGGACCTGG - Intergenic
906701849 1:47865231-47865253 CTCCGCTTGCAGCTGGGACCAGG + Intronic
907370744 1:54001793-54001815 CTGATCTTGGAGCTGGAGCCAGG + Intergenic
908383743 1:63620673-63620695 CTGCTGATGCAAATGGAAGCTGG + Intronic
912392388 1:109312993-109313015 TTGCTGTTGTACATGGAACCAGG - Exonic
912489687 1:110055219-110055241 CTTCTCAGGCAGATGAAACCAGG - Intronic
913961261 1:143339610-143339632 CTGCTCTGGCAAGTGGATCCAGG + Intergenic
914055614 1:144165183-144165205 CTGCTCTGGCAAGTGGATCCAGG + Intergenic
914123532 1:144801179-144801201 CTGCTCTGGCAAGTGGATCCAGG - Intergenic
917037981 1:170770310-170770332 CTGCTCTTCCAAATGAAACTGGG - Intergenic
917452831 1:175161470-175161492 CTGCTGTTGCAGAAGGGTCCAGG - Intronic
920607550 1:207404139-207404161 CTGATGTTGGAGATGGGACCTGG + Intergenic
922137692 1:222847644-222847666 CTCCTCTTGCAGTGGAAACCTGG + Intergenic
1063094637 10:2898830-2898852 CTGTTCTTGGAGGTGGAGCCAGG - Intergenic
1063560553 10:7122358-7122380 CTGCTCTTCCAGCTGGCTCCTGG - Intergenic
1064747277 10:18490524-18490546 CTGCTTTTGCAGATTCTACCTGG - Intronic
1067107983 10:43378199-43378221 CGGCTCTCGCTCATGGAACCTGG + Intergenic
1067168475 10:43884384-43884406 CACCCCTTGCAGGTGGAACCAGG - Intergenic
1069075216 10:64032009-64032031 CTCCTCTTCCTGATGGAACCTGG - Intergenic
1070794024 10:79206621-79206643 CTGCCTTTGCAGAAGGAGCCAGG + Intronic
1073630775 10:105146509-105146531 CTGGTCTTTCAGATGGAGTCAGG - Intronic
1073741301 10:106410172-106410194 CTGTTTTTGAAGATGGAAGCGGG + Intergenic
1074418493 10:113287687-113287709 CTGCTCATGCTCTTGGAACCAGG - Intergenic
1075344893 10:121674812-121674834 CTGCTTTGTCAGATGGATCCAGG - Intergenic
1075746330 10:124730434-124730456 CTGCTGTGGCAGAGGGAACCTGG - Intronic
1076707739 10:132310902-132310924 CAGCTCCTGCTGTTGGAACCCGG - Intronic
1077508029 11:2941126-2941148 CTGCTCCAGCAGAAGGAACCTGG + Intergenic
1080880525 11:36315975-36315997 CTGTTCATGGAGATGGAGCCTGG + Intronic
1081757630 11:45555955-45555977 CTGGTCTTGCTGAGGGAAGCAGG - Intergenic
1087604099 11:100354109-100354131 CTCCTCTTGCAGGTGGAACTGGG - Intronic
1089891558 11:121886601-121886623 CTGCCCTTGCATATGAGACCCGG + Intergenic
1090943282 11:131407747-131407769 CTGGCTTTGCAGCTGGAACCAGG + Intronic
1091628125 12:2138347-2138369 CTGTGCTTGCAGATGGATCCTGG + Intronic
1091782736 12:3224261-3224283 GTGCACTTACAGATGGGACCGGG + Intronic
1093452960 12:19336570-19336592 CTGCTCTTGCATCTGGTTCCTGG - Exonic
1099573021 12:84348878-84348900 CTGCTCTTGCAGGAACAACCAGG + Intergenic
1100958297 12:99934276-99934298 CTGACCTTGCAGAATGAACCTGG + Intronic
1104013937 12:124950149-124950171 CTGCCCTTCCAGCAGGAACCGGG + Exonic
1104587333 12:130057784-130057806 ATGCTTTTCCAGAGGGAACCAGG + Intergenic
1104801379 12:131557097-131557119 CTGCTCATGCAGAGGGCAACTGG + Intergenic
1106406221 13:29476857-29476879 GTGCCCTTGCAGATGGAAGCAGG - Intronic
1107313578 13:39106386-39106408 CAGCTCTTGCAGATGGACAGCGG - Intergenic
1113495681 13:110726649-110726671 CTCCTCGTGCAGCAGGAACCTGG - Intergenic
1113906368 13:113821110-113821132 CTGCCCTTTCGGAGGGAACCCGG - Intronic
1114391101 14:22309502-22309524 CTGCTCCTGCTGATGGAAGAGGG + Intergenic
1114958185 14:27849342-27849364 CTGCTTTTTTAGGTGGAACCTGG + Intergenic
1116034500 14:39611899-39611921 CTGCTCTTGGAGTGGGGACCAGG - Intergenic
1118081152 14:62362213-62362235 CTGTTCTTGAGGATGGAAGCTGG + Intergenic
1121825997 14:97009932-97009954 CTGTTCTTAAACATGGAACCTGG - Intergenic
1122255006 14:100470172-100470194 AGGTTCTTGCAGATGGAACAAGG + Intronic
1124269349 15:28266570-28266592 CTTCTGTTGCAGATGGACCATGG - Intronic
1125364269 15:38897125-38897147 CTGCTATTGCTGATTGAAACAGG - Intergenic
1125377270 15:39043422-39043444 CTGCTCCAACTGATGGAACCAGG - Intergenic
1126367295 15:47908304-47908326 CTGCCTTTGCAGAGGGAAGCTGG + Intergenic
1128535214 15:68485341-68485363 CTCCTCTGGCATATGGAGCCAGG + Intergenic
1130069389 15:80633881-80633903 CTGCTGCTGCTGTTGGAACCAGG + Intergenic
1133173607 16:3997556-3997578 CTGCGCTTGCAGAAGGAAGGGGG + Intronic
1135192074 16:20362572-20362594 CTTCTCTTCCAGATGCACCCTGG - Exonic
1138939760 16:61776081-61776103 ATCCTCTTCCAGATGAAACCTGG - Intronic
1141854607 16:86672597-86672619 CTGCTCACACAGCTGGAACCCGG - Intergenic
1144088747 17:11834469-11834491 CTGCGCTGTCAGATGGGACCAGG - Intronic
1144236804 17:13269462-13269484 CTGCTCTTGCGGGGAGAACCTGG + Intergenic
1144667738 17:17113107-17113129 CTGCCCTTGCAGACGGCTCCTGG + Intronic
1148823600 17:50376065-50376087 GTGCTCTTACAGATGGAAGGTGG + Exonic
1152555377 17:81050305-81050327 CCTCTCTTGCAGATGGAGGCAGG + Intronic
1153777847 18:8469412-8469434 CAGTTCTTGCAGATAGAACCCGG - Intergenic
1157807757 18:50670859-50670881 CTGTTGTTTGAGATGGAACCTGG - Intronic
1158545028 18:58388911-58388933 CTGCTATGGCAGGTGGAGCCTGG + Intronic
1159388788 18:67761020-67761042 CTGCTCTTGCATATGGTAATTGG - Intergenic
1160006621 18:75073278-75073300 CTCCTGTTGAAGATGGAGCCTGG + Intergenic
1160065416 18:75569683-75569705 CAGCTCTTGCAGATTGTACATGG - Intergenic
1160511114 18:79454077-79454099 CTGCTCTTGCAGATGGAACCAGG + Intronic
1160917442 19:1503970-1503992 CTGATCTTGCAGATGACCCCAGG - Intergenic
1161394311 19:4037257-4037279 CTGCTCTTGCAGAGAGAAGTGGG + Intronic
1163324121 19:16592263-16592285 CCCCTCCTGCAGATGGAACTTGG - Intronic
1164782691 19:30906357-30906379 CTGCTTTTGCACTTGGTACCAGG + Intergenic
1165592965 19:36986911-36986933 TGGCTCTTGTAGATGCAACCTGG - Intronic
1202695097 1_KI270712v1_random:117860-117882 CTGCTCTGGCAAGTGGATCCAGG + Intergenic
928096446 2:28407990-28408012 TTCATCTTGCACATGGAACCAGG + Intronic
928784344 2:34864225-34864247 CTGCTCTGCCAGGTGGAGCCAGG - Intergenic
931163873 2:59724310-59724332 CTGCTCTTGCACATTGAATTGGG - Intergenic
932357729 2:71080139-71080161 CTGTTCTTTCAGAAGGGACCTGG - Intergenic
932860388 2:75285575-75285597 CTCCTCTGGCAGAGAGAACCTGG - Intergenic
934103443 2:88674939-88674961 CTGCTATTGAAGATGGCAGCAGG + Intergenic
934276267 2:91574909-91574931 CTGCTCTGGCAAGTGGATCCAGG + Intergenic
935048050 2:99499317-99499339 CTGGTCCTCCAGATGGAAGCTGG - Intergenic
935232168 2:101108596-101108618 CTGGTCTTGGAGATGGAGCAAGG - Intronic
942157760 2:173148919-173148941 CTGCTCTCCCAGATTGAGCCAGG + Intronic
942198453 2:173546445-173546467 CTGCTCTTGCATGAGGGACCTGG + Intergenic
944796892 2:203196216-203196238 CTGCACCTGCAGATGGAACTTGG - Intronic
948290082 2:236818170-236818192 CTGTCCTGGCAGATGGGACCGGG + Intergenic
1168863222 20:1061199-1061221 TTGCTCTGGCTGATGGAACATGG - Intergenic
1169150923 20:3288713-3288735 CAACCCTTGCAGATTGAACCAGG - Intronic
1173646594 20:44637104-44637126 CTGCTTTTGAAAATGGAGCCTGG - Intronic
1174146013 20:48453173-48453195 ATGTCCTTGCAGTTGGAACCTGG - Intergenic
1175224395 20:57436475-57436497 CTGCTCTCTCAGATGGAGCGGGG - Intergenic
1175644325 20:60658332-60658354 ATACTTCTGCAGATGGAACCTGG - Intergenic
1176180163 20:63746195-63746217 AGGCCCTTGCAGAGGGAACCTGG + Exonic
1176625742 21:9090828-9090850 CTACTCATGCTGTTGGAACCTGG - Intergenic
1176936198 21:14870049-14870071 CTGCTATTGCAGATGGAACTGGG - Intergenic
1178230008 21:30771467-30771489 CTTCTCTTGAAGATGAAATCTGG - Intergenic
1178727272 21:35065062-35065084 CTTCTCTTGCAGAGCGAGCCCGG - Intronic
1181633119 22:24161778-24161800 CTGCTGTGGCAGTTGGAACCTGG + Intronic
1184102330 22:42347407-42347429 CTGCTCCAGCAGATGCAGCCTGG + Intergenic
1184701093 22:46173094-46173116 CAGCTCTTGCAGAAGGTACTTGG + Intronic
951132717 3:19067728-19067750 CTGCTCTTGATTATGGTACCTGG - Intergenic
953326365 3:42014985-42015007 CTGCTCTTGTAGTTGGAAATTGG - Intronic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
957384316 3:79476199-79476221 CTGTTCTTGCAGAAGTAAACTGG - Intronic
961312071 3:126008832-126008854 CTGCTCTTGCTGGTGGTCCCAGG - Exonic
961677514 3:128576693-128576715 CTGCCCTTGGAGATGGCACAGGG - Intergenic
964470240 3:157045466-157045488 CTGCCCTTGCTGAGGGAACACGG - Intronic
966435976 3:179884395-179884417 CTGCTTTTGAAGATGGAGCAAGG + Intronic
970645024 4:18109829-18109851 TTGATTTTGCAGATGGAAGCAGG - Intergenic
1202762828 4_GL000008v2_random:126693-126715 CTACTCATGCTGTTGGAACCTGG + Intergenic
991164033 5:63540633-63540655 CTGCTCTTACAGATGTCCCCTGG - Intergenic
991418942 5:66421214-66421236 ATCCTCTGGGAGATGGAACCTGG + Intergenic
992875338 5:81048922-81048944 CTTCTCTTGCACATGCAGCCCGG + Intronic
996307192 5:122060796-122060818 CTGCAGGAGCAGATGGAACCAGG - Intronic
998189079 5:140007210-140007232 CTGCTCTAGGAGAAGGAAACTGG + Intronic
998213932 5:140223295-140223317 CTGCTCTGGCACATGGCCCCTGG + Intronic
999294100 5:150447317-150447339 CTGCTCCTGCAAAGGGAACTAGG + Intronic
1001288395 5:170439682-170439704 CTGCTCCTGCAGCTCGACCCAGG - Intronic
1002301118 5:178257668-178257690 CTGCACTGGCACATGGTACCAGG + Intronic
1004205314 6:13586964-13586986 CTCCCCTGACAGATGGAACCAGG - Intronic
1006610373 6:35291092-35291114 CTGCTCCTGGAGAGGGAAGCAGG + Intronic
1006942107 6:37759289-37759311 CTGCTCTGGCAGATGCAATCAGG + Intergenic
1013643639 6:112113327-112113349 CAGCTTTTGCAGCTGGAACTTGG - Intronic
1014820561 6:125984425-125984447 CTGCCCTAGAAGATGGAACATGG + Intergenic
1015549569 6:134398029-134398051 CTGATATTACAGATGGATCCAGG + Intergenic
1015917356 6:138231022-138231044 CTGCCCCTGCTGATGGAACTGGG + Intronic
1016843058 6:148543913-148543935 CAGCTCCGGCAGATGGAAACTGG - Exonic
1017249011 6:152260045-152260067 CAGCTCTTGAAGATGAAAGCGGG + Intronic
1017513738 6:155137474-155137496 CTGCTCTTTGAGAAGGAACAGGG + Exonic
1018569105 6:165188170-165188192 CTGCTCTCACAGTTAGAACCTGG - Intergenic
1018786978 6:167116151-167116173 CTCTTCTTGCAGTTGGACCCTGG - Intergenic
1019134486 6:169899673-169899695 CTCAACTTGCAGATGGACCCTGG + Intergenic
1019999089 7:4744734-4744756 CTGCTCTTGCTGCGGGAGCCAGG + Intronic
1020963174 7:14831542-14831564 CTGCTTGTGCAGATGTGACCTGG + Intronic
1024479962 7:49852857-49852879 CTACAGTTGCAGATGGAAACTGG + Intronic
1024981484 7:55161112-55161134 CTGCCCCTGCTGAAGGAACCAGG - Intronic
1025944707 7:66096910-66096932 CTGGTCTTGCAGATGGAAGAAGG - Intronic
1029746333 7:102517552-102517574 CTGCTCTTGTGGGTGGACCCCGG + Intronic
1029764271 7:102616531-102616553 CTGCTCTTGTGGGTGGACCCCGG + Intronic
1030689843 7:112520912-112520934 CTGCTCCTGCAGGTGGTAGCAGG + Intergenic
1035619928 8:1029052-1029074 CTGCACTTTCAGCTGGAAACAGG + Intergenic
1035919421 8:3661093-3661115 TTGCTTTAACAGATGGAACCCGG - Intronic
1036576091 8:10028973-10028995 CTCCTCTTCCAATTGGAACCAGG + Intergenic
1038616528 8:29100802-29100824 CTGCTCTTGAAGATGGATTGTGG + Intronic
1040484972 8:47861668-47861690 TTGCTCTGGCAGATGGGACAAGG - Intronic
1040768998 8:50950416-50950438 CTGATCCTGCAGATTCAACCAGG + Intergenic
1046489799 8:114936658-114936680 CTGCCCTTGAAGATGGAGCAAGG + Intergenic
1048505185 8:135014593-135014615 CTGGTCTTGCAGGGGGATCCTGG - Intergenic
1048902548 8:139052892-139052914 CTGCTCTTGGACAATGAACCTGG + Intergenic
1049714917 8:144085253-144085275 AGGCTCTTGGAGATGGACCCTGG - Intronic
1049783516 8:144439696-144439718 CAGCTCTTGCAGAGGCAGCCGGG + Intronic
1053678715 9:40464863-40464885 CTGCTTTTTTAGGTGGAACCTGG + Intergenic
1054285008 9:63160079-63160101 CTGCTTTTTTAGGTGGAACCTGG - Intergenic
1054291793 9:63300401-63300423 CTGCTTTTTTAGGTGGAACCTGG + Intergenic
1054389811 9:64604944-64604966 CTGCTTTTTTAGGTGGAACCTGG + Intergenic
1054505903 9:65911432-65911454 CTGCTTTTTTAGGTGGAACCTGG - Intergenic
1055384110 9:75742576-75742598 CTGCTCTGGGAGATGCCACCAGG - Intergenic
1059453102 9:114383160-114383182 CTGCTCTGGGAGAATGAACCAGG + Intronic
1061136151 9:128735064-128735086 CTGTTCCTGCACATGGAAGCGGG + Intronic
1061150447 9:128825105-128825127 CGGCTCTTCCAGATGCCACCAGG + Intronic
1061936986 9:133863413-133863435 CGGGTCGTACAGATGGAACCGGG + Intronic
1062287523 9:135779632-135779654 GTGCTCTTGATGGTGGAACCAGG + Intronic
1062559680 9:137135828-137135850 CTGCACTTACAAATGGAACGTGG - Intergenic
1203748916 Un_GL000218v1:61249-61271 CTACTCATGCTGTTGGAACCTGG - Intergenic
1203543591 Un_KI270743v1:111574-111596 CTACTCATGCTGTTGGAACCTGG + Intergenic
1189357106 X:40318383-40318405 CTGATCTTGCAGATGGGCTCTGG - Intergenic
1195448165 X:104977156-104977178 CTGATCTTCCACATGGGACCCGG + Intronic
1200063455 X:153494044-153494066 CTGCTCTTGCTGAGGGAAGAAGG + Intronic
1201162274 Y:11176255-11176277 CTACTCATGCTGTTGGAACCTGG - Intergenic