ID: 1160514096

View in Genome Browser
Species Human (GRCh38)
Location 18:79469043-79469065
Sequence ACCCCCGGGATTGTGGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 2, 1: 0, 2: 1, 3: 8, 4: 140}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160514090_1160514096 -9 Left 1160514090 18:79469029-79469051 CCTCACGCTCTGGGACCCCCGGG 0: 2
1: 3
2: 3
3: 21
4: 176
Right 1160514096 18:79469043-79469065 ACCCCCGGGATTGTGGGGAAGGG 0: 2
1: 0
2: 1
3: 8
4: 140
1160514078_1160514096 28 Left 1160514078 18:79468992-79469014 CCTCACGCTCTGGGACCCCCGGG 0: 2
1: 3
2: 3
3: 21
4: 176
Right 1160514096 18:79469043-79469065 ACCCCCGGGATTGTGGGGAAGGG 0: 2
1: 0
2: 1
3: 8
4: 140
1160514085_1160514096 11 Left 1160514085 18:79469009-79469031 CCCGGGATTGTGGGGAAGAGCCT 0: 2
1: 5
2: 0
3: 20
4: 246
Right 1160514096 18:79469043-79469065 ACCCCCGGGATTGTGGGGAAGGG 0: 2
1: 0
2: 1
3: 8
4: 140
1160514084_1160514096 12 Left 1160514084 18:79469008-79469030 CCCCGGGATTGTGGGGAAGAGCC 0: 2
1: 3
2: 1
3: 6
4: 102
Right 1160514096 18:79469043-79469065 ACCCCCGGGATTGTGGGGAAGGG 0: 2
1: 0
2: 1
3: 8
4: 140
1160514083_1160514096 13 Left 1160514083 18:79469007-79469029 CCCCCGGGATTGTGGGGAAGAGC 0: 2
1: 3
2: 1
3: 6
4: 118
Right 1160514096 18:79469043-79469065 ACCCCCGGGATTGTGGGGAAGGG 0: 2
1: 0
2: 1
3: 8
4: 140
1160514086_1160514096 10 Left 1160514086 18:79469010-79469032 CCGGGATTGTGGGGAAGAGCCTC 0: 3
1: 2
2: 2
3: 13
4: 165
Right 1160514096 18:79469043-79469065 ACCCCCGGGATTGTGGGGAAGGG 0: 2
1: 0
2: 1
3: 8
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160514096 Original CRISPR ACCCCCGGGATTGTGGGGAA GGG Intronic
901221415 1:7586001-7586023 ATCCCCAAGATTGTGGGAAAAGG + Intronic
902850393 1:19151071-19151093 ACCCCTGGGAGTGAGGGGTAGGG - Intronic
905044553 1:34985410-34985432 ACCCCCTGGAGGGTGGGGGACGG - Intronic
905270250 1:36782946-36782968 AACCCCTGCCTTGTGGGGAATGG - Intergenic
905312395 1:37059001-37059023 ACCCCTGGGACAGTGGGGAGTGG - Intergenic
908246047 1:62228403-62228425 ACCACTGGGATTGTGGGAGAGGG + Intergenic
910984561 1:92992975-92992997 ACCCCTGGGATTCTGGAGAAAGG - Intergenic
915512890 1:156396272-156396294 AGCCCAGGGATGGAGGGGAAAGG + Intergenic
1071492161 10:86143501-86143523 AGCCAAGGGATTCTGGGGAAGGG - Intronic
1071807569 10:89141473-89141495 ACCCCAGAGATTAGGGGGAAAGG + Intergenic
1075793014 10:125098919-125098941 ACCACTGGGTGTGTGGGGAATGG + Intronic
1076001840 10:126918702-126918724 ACCCCCGGGACAGTTGGCAATGG - Intronic
1076568559 10:131415751-131415773 TCCCCCCGGGTTCTGGGGAAGGG - Intergenic
1076607164 10:131696560-131696582 ACTACCTGGATTGTGGGGAATGG + Intergenic
1080521642 11:33072527-33072549 CCCCCAGGGACTGTGGGCAATGG - Exonic
1082938353 11:58677473-58677495 GCCCCTGGTATTCTGGGGAATGG - Intronic
1083616642 11:64029526-64029548 ACCCCCGGGACAGTGAGGAAGGG - Intronic
1085666756 11:78420781-78420803 ACCCCAGGCTTTGTGGGGAGTGG - Intergenic
1087903704 11:103671334-103671356 ACTCAGGGGATTGTGGGGAGAGG - Intergenic
1088823303 11:113474707-113474729 CCTCCCGAGATTGTGGGGAGCGG + Intronic
1089620085 11:119717218-119717240 ACCCCTGGGAGGGTGGGGAACGG + Intronic
1091164723 11:133465034-133465056 ACCACCAGGTTTGTGGGGATTGG - Intronic
1091853681 12:3721840-3721862 ACCCCCAGGGCTGTGGGGAGGGG + Intronic
1093866113 12:24229168-24229190 ACCGCCGAGTTTGTGTGGAAGGG + Intergenic
1094672894 12:32588076-32588098 ACCACAGGGATGGAGGGGAATGG + Intronic
1095986848 12:48004725-48004747 AGCCCCGGGTTTGGGGGGCAGGG - Intergenic
1100299827 12:93296707-93296729 ACCCCTGTGATGGTGAGGAAAGG - Intergenic
1101016011 12:100501294-100501316 AGCTCTGGGATTGTGAGGAAGGG + Intronic
1112482599 13:99790792-99790814 ATCCCCAGAATGGTGGGGAAGGG - Intronic
1112827532 13:103408799-103408821 ACCACCAGGAATGTGGAGAATGG + Intergenic
1119867568 14:77986505-77986527 ATCTCCTGGATTGTGAGGAAAGG + Intergenic
1120578642 14:86217724-86217746 ACCCCGGGGCGAGTGGGGAACGG - Intergenic
1120831458 14:89000945-89000967 ACCCCCATGTTTGTGGGTAAGGG - Intergenic
1122550232 14:102545301-102545323 GCCCCCGGCCTTGTGGGGAAGGG + Intergenic
1127302345 15:57667287-57667309 ACCCCTGGGCCTGAGGGGAATGG + Intronic
1127959885 15:63882824-63882846 ACCCCAGGCAGTGTGGGGAGAGG + Intergenic
1128178403 15:65577992-65578014 TCCCCCAGGAATGTTGGGAATGG - Exonic
1130056166 15:80527929-80527951 ACTCCCAGGAATGTAGGGAAGGG - Intronic
1141720830 16:85754377-85754399 ATCCCCTGGAGTGCGGGGAAAGG + Intergenic
1142077770 16:88130388-88130410 ACCACAGGGCGTGTGGGGAAAGG + Intergenic
1143359604 17:6358290-6358312 ACCACCAGGCTTCTGGGGAACGG - Intergenic
1147560018 17:41502949-41502971 ACCGCCGGGATGCTGAGGAATGG - Exonic
1147906509 17:43826670-43826692 AGACCTGGGATGGTGGGGAAGGG + Intronic
1148546787 17:48525246-48525268 ATGCCCGGGTTTGTGGGGAGTGG + Intergenic
1149873177 17:60202084-60202106 ACACCTGGAATTGTGGTGAAAGG + Intronic
1150086957 17:62279311-62279333 ACACCTGGAATTGTGGTGAAAGG + Intronic
1150124333 17:62627113-62627135 TCCCCCGGTCTGGTGGGGAAGGG - Intergenic
1152633624 17:81421516-81421538 ACCCCTGCGAGTGTGGGGGACGG - Intronic
1153146174 18:2034988-2035010 AACCCCAGAATTGTGTGGAACGG - Intergenic
1155693475 18:28654885-28654907 ACACCAGGGCTTGTGGGGACTGG + Intergenic
1157155591 18:45262425-45262447 ACCGCAGGGATTCTGAGGAAGGG + Intronic
1160458242 18:79018328-79018350 ACCCGGGGAATCGTGGGGAATGG - Intergenic
1160514059 18:79468932-79468954 ACCCCCGGGATTGTGGGGAAGGG + Intronic
1160514096 18:79469043-79469065 ACCCCCGGGATTGTGGGGAAGGG + Intronic
1161233877 19:3188586-3188608 AAACCCAGGATTGTGGGCAAAGG - Intronic
1161371593 19:3914988-3915010 ACCCCCCGGAGCTTGGGGAAGGG + Intronic
1162966610 19:14159206-14159228 ACCTCCAGGACTGTGGGGACAGG + Exonic
1164555264 19:29246326-29246348 ACCCCCAGGGTTGTGGGGAAAGG - Intergenic
1164746301 19:30617289-30617311 ACTCTGGGGACTGTGGGGAAAGG - Intronic
1165405673 19:35629394-35629416 ACCTTCGGGATTGTGGGGGCGGG + Intronic
1166078005 19:40425359-40425381 ACTCCCCGGACTGCGGGGAAGGG - Intronic
1167249034 19:48391083-48391105 ACCCCCGCCAGTCTGGGGAAGGG + Intronic
1167561603 19:50229210-50229232 ACCCCAGGGCTTCTGGGAAATGG + Intronic
926413093 2:12625412-12625434 TCCCCAGGGAGTCTGGGGAAGGG + Intergenic
927930674 2:27041493-27041515 ACCCCCAGCATGATGGGGAATGG - Exonic
928211571 2:29327765-29327787 ATCCACTGGATTGTGGGGGAAGG + Intronic
929806712 2:45152874-45152896 AACCCTGGCATTGTGGGGAGGGG + Intergenic
929921365 2:46174142-46174164 ACCAATGAGATTGTGGGGAAGGG + Intronic
930337092 2:50061953-50061975 ACTACAGGGATTGGGGGGAAGGG - Intronic
937334633 2:121054421-121054443 ACACAATGGATTGTGGGGAAGGG + Intergenic
938242561 2:129754674-129754696 AATCCCTGGATTGAGGGGAATGG - Intergenic
941774635 2:169379064-169379086 AACCCAGGGACTTTGGGGAAAGG - Intergenic
947007469 2:225528757-225528779 AACCCCTGGATTGTAGGGATTGG + Intronic
948094589 2:235323724-235323746 ACCCCCAGGGTTGTGGGTAGGGG + Intergenic
948204667 2:236156920-236156942 ACCACCGGGACTGTGGGCACTGG - Intergenic
1168924451 20:1567611-1567633 ACCCCAGGGCTGGTGGTGAATGG + Intronic
1170383843 20:15794632-15794654 ACCCCTGGAGTTGTGGGGATGGG - Intronic
1170566699 20:17611800-17611822 GCCCCGGTGAGTGTGGGGAACGG - Intergenic
1170821449 20:19758492-19758514 TCCTCGGGGATCGTGGGGAACGG + Intergenic
1172015455 20:31870327-31870349 GCCCCCGGGATCATGGGCAATGG - Exonic
1175172797 20:57091958-57091980 ACCCCCAGGAGAGGGGGGAAGGG + Intergenic
1175888574 20:62305966-62305988 ACACCCGGGATTGCGGCGGATGG + Intronic
1178160244 21:29904108-29904130 ACACCAGGGCCTGTGGGGAATGG + Intronic
1184031625 22:41898487-41898509 ACACCCAGGATTCTGGGGGAGGG - Intronic
1184474478 22:44713097-44713119 ATGCCCGGGAGTGTGGGGAGGGG + Intronic
1184763753 22:46561053-46561075 ACCCCCAGGAGGGTGAGGAAGGG + Intergenic
1185251106 22:49802161-49802183 GCCCCCGCGATGTTGGGGAAAGG - Intronic
1185251118 22:49802208-49802230 GCCCCCGCGATGTTGGGGAAAGG - Intronic
1185251130 22:49802255-49802277 GCCCCCGCGATGTTGGGGAAAGG - Intronic
1185251142 22:49802302-49802324 GCCCCCGCGATGTTGGGGAATGG - Intronic
1185251154 22:49802349-49802371 GCCCCCGCGATGTTGGGGAAAGG - Intronic
1185251166 22:49802396-49802418 GCCCCCGCGATGTTGGGGAAAGG - Intronic
1185251178 22:49802443-49802465 GCCCCCGCGATGTTGGGGAAAGG - Intronic
1185251201 22:49802537-49802559 GCCCCCGCGATGTTGGGGAAAGG - Intronic
1185251213 22:49802584-49802606 GCCCCCGCGATGTTGGGGAAAGG - Intronic
1185251225 22:49802631-49802653 GCCCCCGCGATGTTGGGGAAAGG - Intronic
1185251237 22:49802678-49802700 GCCCCCGCGATGTTGGGGAAAGG - Intronic
950128890 3:10528221-10528243 AGCCCTGGGAACGTGGGGAAAGG + Intronic
953019910 3:39106926-39106948 AGCCACGGGATAGTGGGGAGCGG - Intronic
953687700 3:45091166-45091188 ACCCCAAGGACTGTGGGTAAGGG - Exonic
954200755 3:49021899-49021921 TCCCCCGGGACTATGGGCAAGGG + Exonic
954529547 3:51307022-51307044 AGCCCTGGGGATGTGGGGAAGGG - Intronic
954863678 3:53711379-53711401 ACTCCAGGGATTCTGAGGAAGGG - Intronic
956644771 3:71444861-71444883 ACCCAAGGGATTGGGGGGAGTGG + Intronic
961664966 3:128489078-128489100 ACCCCCGGGAGAGTGGGGGAGGG + Intronic
964607497 3:158572896-158572918 CACCCCGGGAGTGTGAGGAAGGG - Intronic
966504099 3:180679638-180679660 ACCCCCGGGAACGTCGGGAGGGG - Intronic
968518071 4:1023195-1023217 CCCCTCGGCATTGTGTGGAATGG + Intronic
969886154 4:10217413-10217435 ACCCTGGGAGTTGTGGGGAAGGG - Intergenic
975584930 4:75940326-75940348 CCTCCCGGGAGTGGGGGGAAGGG + Intronic
985564334 5:607785-607807 CCGCCCGGGGATGTGGGGAAAGG + Intergenic
987745638 5:21968244-21968266 TCCCCAGGGATTGTGGCAAATGG + Intronic
991765836 5:69978371-69978393 TCCCCAGGGATTGTGGCAAATGG + Intergenic
991781486 5:70139791-70139813 TCCCCAGGGATTGTGGCAAATGG - Intergenic
991845072 5:70853443-70853465 TCCCCAGGGATTGTGGCAAATGG + Intergenic
991873929 5:71140105-71140127 TCCCCAGGGATTGTGGCAAATGG - Intergenic
992222577 5:74587424-74587446 ATCCCCAGGTCTGTGGGGAAGGG - Intergenic
998596155 5:143532608-143532630 ACCTCTGGGAATATGGGGAAGGG + Intergenic
1004179965 6:13372567-13372589 ACCCCTGGGAGTCTGGGCAAGGG + Intronic
1007664919 6:43508475-43508497 GACACAGGGATTGTGGGGAAGGG - Intronic
1008464619 6:51816912-51816934 ACCCCAGGGAGTGGAGGGAAGGG - Intronic
1012398310 6:98824637-98824659 AGCCTTGGGATTGTGGGGATGGG - Intergenic
1017556693 6:155579479-155579501 TGCCCCGTGATAGTGGGGAAGGG + Intergenic
1022114935 7:27252924-27252946 GCCCCGGGGGTCGTGGGGAAGGG + Intergenic
1022602749 7:31777258-31777280 TCCCCAGGGATTCTGGGGTAGGG - Intronic
1022633160 7:32105110-32105132 ACCAACGGGATAGTGGGAAATGG + Intronic
1026741795 7:72983517-72983539 ACCCTGGGGTTTGTGGGGAGAGG + Intergenic
1027101940 7:75381560-75381582 ACCCTGGGGTTTGTGGGGAGAGG - Intergenic
1028247534 7:88499224-88499246 ATACCAGGGATGGTGGGGAAAGG - Intergenic
1032267986 7:130381684-130381706 ACCGCCTGGATGCTGGGGAAGGG - Exonic
1033396045 7:140974693-140974715 ACCCCTGGGATCCTTGGGAATGG + Intergenic
1036447829 8:8838286-8838308 AACCCCAGGATTGAGGGGAAGGG + Intronic
1039255355 8:35712608-35712630 ACCCTCTGCATTTTGGGGAAAGG - Intronic
1039884252 8:41646356-41646378 GCCCCCAGGAGCGTGGGGAAGGG + Exonic
1040802502 8:51358751-51358773 TCCCCTGGGGTTGTGGGGGAGGG - Intronic
1045981683 8:108197068-108197090 ACCCCCGAGCTTGAAGGGAAAGG + Intergenic
1046344404 8:112903532-112903554 ACCTCAGGGAGTATGGGGAAGGG + Intronic
1053214407 9:36258571-36258593 ACCGCCGGGAAGGTGGGGGACGG - Intronic
1056262672 9:84864336-84864358 ACTTCCGGGACTGTGGGGAAAGG + Intronic
1056373715 9:85986013-85986035 ATCCCCAGGATGGTGGTGAAGGG + Intronic
1056459428 9:86795194-86795216 ACCCCCGTGTTTGTGGCGACTGG + Intergenic
1056665048 9:88574894-88574916 GCCCCCAGGATGGTGGGGACAGG - Intronic
1058939652 9:109801259-109801281 CCCCCAGGGATAGTGGTGAAGGG + Intronic
1059734237 9:117085699-117085721 ACCCCTGAGATGTTGGGGAAAGG - Intronic
1061618220 9:131794007-131794029 TCCCCAGGGAATGTGGGGGACGG + Intergenic
1187463888 X:19512158-19512180 ACCCCAGGGCCTGTGGGGAGTGG + Intronic
1189480404 X:41388247-41388269 AGTCCCGGGATTGTGGGGGTGGG + Intergenic
1196734316 X:118971456-118971478 CCCCCCTGGAATGAGGGGAAGGG - Intergenic
1199214132 X:145247333-145247355 ATCCCTGGGCTTGTGGGGGAGGG - Exonic
1200050138 X:153424913-153424935 AAGCCTGAGATTGTGGGGAATGG + Intergenic
1200428225 Y:3045985-3046007 ACCACCGGGAATGTGAGGCAGGG - Intergenic