ID: 1160514491

View in Genome Browser
Species Human (GRCh38)
Location 18:79470903-79470925
Sequence CCTGCCCCCCGCCCCAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 689
Summary {0: 1, 1: 0, 2: 13, 3: 54, 4: 621}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160514491_1160514501 26 Left 1160514491 18:79470903-79470925 CCCTCCCTGGGGCGGGGGGCAGG 0: 1
1: 0
2: 13
3: 54
4: 621
Right 1160514501 18:79470952-79470974 GAATGTATGAGCCCCATGAACGG 0: 1
1: 0
2: 0
3: 5
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160514491 Original CRISPR CCTGCCCCCCGCCCCAGGGA GGG (reversed) Intronic
900394062 1:2446005-2446027 CCTGCCACCTGCTCCAGTGATGG + Intronic
900438767 1:2643225-2643247 CCTGCGCCCCGCCCCTCGGCAGG - Intronic
900530606 1:3151188-3151210 CCTGCCCCCATGCCCAGCGAGGG - Intronic
900625323 1:3605885-3605907 CCCGGCCCCCACCCAAGGGATGG + Intronic
900626679 1:3611645-3611667 CCAGCGCCCCGCCCCCGGCACGG + Intergenic
900661771 1:3788242-3788264 CCTGCCCCACCACCCAGGCAAGG - Intronic
900682475 1:3924544-3924566 CCTGCCTCCCTGCCCAGCGATGG + Intergenic
900709859 1:4106964-4106986 CCTGACCACAGCCCCAGAGAGGG - Intergenic
900754083 1:4421509-4421531 CCTGCCCCCCAACACTGGGATGG + Intergenic
900836839 1:5011246-5011268 CTTGCTCCATGCCCCAGGGAGGG + Intergenic
901066651 1:6497469-6497491 CCCGCCCCCCGCCCCCGAGGCGG - Intronic
901259749 1:7862712-7862734 AATGCCCCGCACCCCAGGGAGGG + Intergenic
901491958 1:9601289-9601311 CCAGCCCTCGGCCCCAGGGGTGG - Exonic
901644643 1:10709910-10709932 CCTGGGCCCCGGACCAGGGAGGG + Intronic
901843185 1:11966347-11966369 CCTGCCCCCTGCAGCAGGCAAGG - Intronic
902401030 1:16156842-16156864 CCTGGCCCCCGACCCTGGCATGG + Intergenic
902700645 1:18169620-18169642 CCTGCCCCCAGCCCAGGGTAGGG + Intronic
903193380 1:21668848-21668870 CTTGGGCCCCTCCCCAGGGATGG + Intronic
903233726 1:21936927-21936949 CCCGCCCCCAGCCCCACGAAGGG + Intronic
903259617 1:22124259-22124281 CCTGGCCCCTGGCCCAGGAAAGG - Intronic
903297068 1:22350716-22350738 CCTGTCCCCTGGCCAAGGGATGG + Intergenic
903332472 1:22603074-22603096 CCTGCCAACGGCCCCCGGGATGG - Exonic
903339350 1:22644143-22644165 CCTGCCCGGGGCACCAGGGAAGG + Exonic
903536046 1:24066982-24067004 CCTGCCCCCAGGCCCAGTGCAGG - Intronic
903703445 1:25267679-25267701 CCTGCCACCCACCCCTGAGAGGG + Intronic
903712712 1:25338008-25338030 CCTGCCACCCACCCCTGAGAGGG + Exonic
903859275 1:26355199-26355221 CCAGCCCTCAGCCCCAGGGCGGG - Intergenic
904254351 1:29245107-29245129 CCTGGCCCCCAGCCCAGGGCAGG - Intronic
905013743 1:34763254-34763276 TCTGCCCTCCGCTACAGGGATGG + Exonic
905627311 1:39497746-39497768 CCTGCCCCCCACCCCGTGGCAGG + Intronic
905880034 1:41457384-41457406 CATGCTCCCCTCCCCAGTGAAGG - Intergenic
906293072 1:44632258-44632280 CCTGGCCCCCGCCCCAGCACCGG - Intronic
906411850 1:45584736-45584758 CCCGCCCCCTGCCCCAGGGCCGG - Intronic
907359702 1:53904542-53904564 CCTACCCCCCACCCCAGGATGGG - Intronic
908102253 1:60803666-60803688 CCTGCCCCCCACCCCACGACAGG + Intergenic
910600650 1:89028667-89028689 CCTGCCCCCCACCCCACGACAGG + Intergenic
912383586 1:109260512-109260534 CCTGGTCCCATCCCCAGGGAGGG + Intronic
913407495 1:118511933-118511955 CCTGCCCCCTACCCCAGGACAGG + Intergenic
913615765 1:120558342-120558364 CCCGCCCCCTGCCCGAGGGGCGG - Intergenic
914574510 1:148952560-148952582 CCCGCCCCCTGCCCGAGGGGCGG + Intronic
915330258 1:155107221-155107243 CCTGCCCCCAACCCCAGGAGTGG + Intergenic
916510586 1:165469357-165469379 CCTCACCCCCACCCCTGGGAAGG - Intergenic
917243057 1:172970375-172970397 CCTGCCCTGGGCACCAGGGAAGG - Intergenic
918044839 1:180935544-180935566 CCCGCGCCCCGCCCAGGGGAAGG + Exonic
919377582 1:196814212-196814234 CCTGCCCCCCACCCCATGATAGG + Intergenic
919387096 1:196936109-196936131 CCTGCCCCCCACCCCATGATAGG + Intronic
919682651 1:200451765-200451787 CCTGCCCCCCACCCCACGACAGG + Intergenic
919767376 1:201136055-201136077 CCTTTCCCAGGCCCCAGGGAGGG - Intronic
919866846 1:201788857-201788879 CCCTCCCCCAGCCCCAGTGATGG - Intronic
920194305 1:204216808-204216830 CCTGCCCCCACCCCCAGCCATGG + Intergenic
920386810 1:205575435-205575457 CCTGCCTGCCACCCCAGGGGTGG - Intronic
920698680 1:208201339-208201361 ACTGACCCCCTCCCCAGGGTGGG - Intronic
921265366 1:213417065-213417087 ACTTCCCACCACCCCAGGGATGG + Intergenic
921623225 1:217349504-217349526 CATTGCCCCCGACCCAGGGAAGG + Intergenic
922591483 1:226780542-226780564 CCTGTCACCCGCCTCATGGATGG + Intergenic
922617852 1:226973667-226973689 GCTGCCCCCAGCCTCAGGGGAGG - Intronic
922801603 1:228367180-228367202 CCTGCCCTCAGCCCCTGAGACGG + Intronic
922804312 1:228377738-228377760 CCTGCCCCCCGCCCCAGGTGAGG - Intronic
924733301 1:246731861-246731883 CCTGCCCCCCACCCCACGACAGG + Intronic
1063105600 10:2989060-2989082 CCTGCCCCCATCACCAGTGAGGG - Intergenic
1063343694 10:5292525-5292547 CTTACCCCCCTCCCCTGGGAGGG - Intergenic
1063872994 10:10439776-10439798 CCTCTCCCCCGCCCCAGGACAGG - Intergenic
1064141346 10:12793217-12793239 ACTTTCCCCAGCCCCAGGGAAGG - Intronic
1064193281 10:13225789-13225811 CTTGAGCACCGCCCCAGGGATGG + Intronic
1065050272 10:21784893-21784915 CCTGCCCCCCACCCCATGACAGG - Intronic
1066383439 10:34921236-34921258 CAAACCCCCCACCCCAGGGAAGG + Intergenic
1067686062 10:48466570-48466592 CGCGCCCGCCGCCCCAGGTAGGG - Intronic
1069813578 10:71179714-71179736 CCTGCCTCCAGCACCTGGGAGGG - Intergenic
1070148058 10:73788972-73788994 CCCACCCCCCGCCCTGGGGAAGG + Intronic
1070476953 10:76838179-76838201 CCTGCCCCCCTCCCCATGACAGG - Intergenic
1070952737 10:80444128-80444150 GCTGCACCCTGCACCAGGGATGG + Intergenic
1071350292 10:84733736-84733758 CCTGCCCCCCACCCCACGACAGG - Intergenic
1072045439 10:91650129-91650151 CTTGCCCCCCACCCCCTGGAAGG - Intergenic
1072091784 10:92136004-92136026 CCTGCCCCCCACCCCATGACAGG - Intronic
1072763905 10:98080816-98080838 CCAGCCCCAGGCCCCAGGCAGGG - Intergenic
1073249981 10:102115227-102115249 CCTCCCCCGAGCCCCAGGCACGG + Intronic
1073295916 10:102438620-102438642 CCTAGCCCCAGCCCCAGTGAGGG - Intergenic
1074578765 10:114696194-114696216 CCTGCTGCCCTCTCCAGGGATGG - Intergenic
1074945779 10:118279214-118279236 CCTCTCTCCCTCCCCAGGGAGGG + Intergenic
1075297712 10:121292635-121292657 CCTGCCCCCACCGCCGGGGAGGG - Intergenic
1076714077 10:132354487-132354509 CCAGCCCCCAGCCCCAGCCAGGG - Intronic
1076798478 10:132810017-132810039 CCTGGCCCCCTCCCCAAGCAAGG - Intronic
1076894323 10:133302453-133302475 CCTGCCCCCTGCACCAGAGGTGG + Intronic
1076894334 10:133302483-133302505 CCTGCACCCTGACCCAGGGGCGG + Intronic
1076894362 10:133302605-133302627 CCTGCACCCTGACCCAGGGGTGG + Intronic
1076894390 10:133302697-133302719 CCTGCACCCTGACCCAGGGGTGG + Intronic
1076894638 10:133303939-133303961 CCTGCCCCCTGACCCAGGGGTGG - Intronic
1077036100 11:495197-495219 CCTGCCCAGGGCCACAGGGACGG - Intronic
1077051722 11:569564-569586 CCTGCCCCCTGCCCCAGCCCCGG + Intergenic
1077112111 11:866448-866470 CCTGACCCCGACCCCAGGGTGGG - Intronic
1078005178 11:7527166-7527188 CTTGCCTCCCCTCCCAGGGATGG - Intronic
1078090088 11:8259644-8259666 CCTGCCTCCCTCTCCAGGGTTGG + Intronic
1078443272 11:11385196-11385218 TCTCCCCACCACCCCAGGGAGGG + Intronic
1078825208 11:14923233-14923255 CCTGCCCCAAGTGCCAGGGATGG - Intronic
1079114825 11:17634424-17634446 TCTGCCCCTGCCCCCAGGGAGGG - Intronic
1079126513 11:17721520-17721542 CCGCCCACCCGCCCGAGGGATGG + Exonic
1079251977 11:18793167-18793189 CCACCCCCCCGCCCCCGAGACGG + Intergenic
1081651036 11:44824370-44824392 CCTGCCCCCAGCCCCAGTTGGGG - Intronic
1081870758 11:46381619-46381641 TCTCCCCACCCCCCCAGGGAAGG - Intronic
1081967822 11:47180142-47180164 CCTGGCCCCCGCCCAGGGCACGG - Intronic
1083857305 11:65399610-65399632 ACTGAAACCCGCCCCAGGGAAGG - Intronic
1084031621 11:66484633-66484655 CCTTCCCCCAGCTCCAGGGGTGG - Intronic
1084084189 11:66847414-66847436 CCTGCCCCCCACCCCGGAGATGG - Intergenic
1084128893 11:67118794-67118816 CCTCCCCCACCCCCCTGGGAGGG - Intergenic
1084409801 11:69000150-69000172 CCTGCCTCCAGCTCCTGGGAGGG + Intergenic
1084460678 11:69295021-69295043 CCCACCCCCTGCCCCAGAGATGG + Intronic
1084478083 11:69400204-69400226 CCTACCCCCACTCCCAGGGATGG - Intergenic
1084480904 11:69419478-69419500 TCTGCCCCCTGCAGCAGGGAAGG - Intergenic
1084698909 11:70773056-70773078 CCTGCCCACAGCCCTGGGGATGG - Intronic
1085307753 11:75497822-75497844 CCTGCTCCCAGCCCCATGGCCGG - Intronic
1086253090 11:84840833-84840855 CCTGCCCCCTACCCCAGGACAGG - Intronic
1086453394 11:86938721-86938743 CCTACCCCCAGCCCCTCGGAAGG - Intronic
1086811520 11:91316447-91316469 CCTGCCCCCCACCCCACGACAGG + Intergenic
1086910443 11:92465706-92465728 CCTGCCCCCCACCCCATGACAGG - Intronic
1087874533 11:103339855-103339877 CTTTCCCTCTGCCCCAGGGATGG + Intronic
1089053269 11:115564481-115564503 CCTGCCCAGCACCCCTGGGAGGG - Intergenic
1089165406 11:116472140-116472162 CCAGCCCCCAGCTCTAGGGAGGG + Intergenic
1089298552 11:117484034-117484056 CCTGCCCCCCGCCCCTGCCCCGG + Intronic
1089442902 11:118531240-118531262 CCCGCCCCCCGCCACCGGGGCGG - Intronic
1089454408 11:118617660-118617682 CCTGCCCCCTACCCGAGGGCAGG - Intronic
1089672057 11:120063372-120063394 TCTGAGCCCCTCCCCAGGGAGGG + Intergenic
1090119931 11:124015616-124015638 CCTTCCCCATGCCCCAGGGCTGG + Exonic
1090120576 11:124023054-124023076 CCTTCCCCATGCCCCAGGGCTGG + Exonic
1090121938 11:124038938-124038960 CCTTCCCCATGCCCCAGGGCTGG - Exonic
1091157237 11:133385020-133385042 CCTGCCCACAGCCACAAGGAGGG - Intronic
1091764123 12:3107178-3107200 CCTCCCCCACTCCCCACGGAGGG - Intronic
1092604993 12:10108836-10108858 CCTGCCCCCCGCCCCACAACAGG - Intronic
1092821413 12:12357009-12357031 CCGCCCCCCGGCCCGAGGGAGGG - Intergenic
1092856068 12:12674951-12674973 CCTGACCCCAGCCCAGGGGAGGG - Intronic
1094234821 12:28151695-28151717 CCTGCCCCCCACCCCACGACAGG + Intronic
1095198687 12:39356297-39356319 CTTGCCCCCAGCCCCAGTCATGG + Intronic
1095672539 12:44876907-44876929 CCAGCGCCCCGCCCCCGGCAGGG - Exonic
1095947788 12:47763633-47763655 GCTGCCCCCCACCCCAGGAATGG - Intronic
1096041183 12:48519127-48519149 CCTGCCCCCCACCCCATGACAGG + Intronic
1096244195 12:49975245-49975267 CCTGGGCTCAGCCCCAGGGAGGG + Intronic
1096592247 12:52668082-52668104 CATGCCCCCTTCACCAGGGAAGG + Intergenic
1097013108 12:55966962-55966984 CCAGGCCCCCGCTCCAGGGCCGG + Exonic
1098442774 12:70535674-70535696 CCTGCCCCTCATCCCAGGAAAGG - Intronic
1098820232 12:75218768-75218790 CCTGCCCCCCACCCCATGACAGG + Intergenic
1100685887 12:96985704-96985726 CCTGCCCCGCACCCCAGCGCGGG - Intergenic
1101131805 12:101697801-101697823 CCTGCCCCCAGCGCCAGGCGCGG + Exonic
1103358957 12:120342495-120342517 CCTGCCCTCCTCTCCAGGGCTGG + Exonic
1104003222 12:124873694-124873716 CCTCCCCTCAGCCCCAGGGTGGG + Intronic
1104309634 12:127642918-127642940 CCTCCCCCCATCCCAAGGGATGG + Intergenic
1104685479 12:130781833-130781855 CCTGCCCCCCGCCTCACAGCTGG - Intergenic
1104685520 12:130781958-130781980 CCTGCCCCCCGCCTCACAGCTGG - Intergenic
1104957136 12:132472493-132472515 ACTGCCCCCTGCCCGAGGAAGGG + Intergenic
1105448183 13:20475246-20475268 CCTGCCACCCCTGCCAGGGAGGG - Intronic
1108572818 13:51767769-51767791 CCCCCCCCCCGCCCCAGGAGAGG - Intergenic
1109833612 13:67826367-67826389 CCTCCCCCCCACCCCACGGCAGG - Intergenic
1110217097 13:73035052-73035074 CCTCCCACCCCCTCCAGGGATGG - Intergenic
1110318637 13:74135692-74135714 CCTGCCCCGCGCCCCCGGCCCGG + Intergenic
1112330795 13:98475660-98475682 CCTGCGCCCCGCCCCTGCCATGG - Intronic
1112494540 13:99894724-99894746 CCCCCCCCCCGCCTCAGGCAAGG - Exonic
1113553956 13:111216348-111216370 CCTCCACCCAGCCACAGGGAAGG - Intronic
1113960051 13:114121192-114121214 CCTGCCCCCGGCCGCAGTGCTGG - Intronic
1114679217 14:24470454-24470476 CCTGCCCCCCACCCCACGACAGG + Intergenic
1116403743 14:44542499-44542521 CCTGCCCCCCGCCCCATGACAGG - Intergenic
1116914466 14:50509225-50509247 CCTGCCCCCCACCCCATGACAGG - Intronic
1117912415 14:60648495-60648517 CCTGCGCGCCGCCCCGTGGACGG + Intronic
1117928648 14:60813195-60813217 CCAGCCATCCGCCCCAGGCACGG - Intronic
1117971303 14:61253505-61253527 CCTGCCCCCCACCCCAGTGAAGG - Intronic
1118346778 14:64946813-64946835 CCTGCCCACCGTCCCAAGGTGGG - Exonic
1118359690 14:65045418-65045440 CCTCCCCGCCGCCCCCGAGATGG + Intronic
1118819050 14:69333203-69333225 CCAGGCCCCTGACCCAGGGAAGG - Intronic
1120710212 14:87785697-87785719 CCACCCCCCAGCCCTAGGGAAGG + Intergenic
1121145423 14:91578246-91578268 CCCCCCCCCCGCCCCATGGTGGG + Intergenic
1121566529 14:94914338-94914360 CCTGCCCCAGGGCCCAGTGATGG + Intergenic
1121645808 14:95516550-95516572 CCGGCCCCCGGCCCCAGGCCTGG + Intronic
1122695548 14:103550529-103550551 TCTGCTCCCCACCCCAGGGCTGG + Intergenic
1122847480 14:104507819-104507841 CCTGCCCCACCCGACAGGGATGG + Intronic
1122879198 14:104682456-104682478 CCTGCCCCGCGCCCCACTGCAGG - Intergenic
1122891117 14:104732710-104732732 CCTGCCCCCCCGCCCAGGCGGGG + Intronic
1122959989 14:105089915-105089937 CCAGCCCCCCACACCAGGGGAGG - Intergenic
1122999036 14:105282183-105282205 CCTGCCCCTTCCCCCTGGGATGG - Intronic
1123036644 14:105474504-105474526 CCTGCCCGCCGCCCCGGGGACGG + Intronic
1124208103 15:27740404-27740426 CCTGACCATCGCCCCTGGGAGGG + Intergenic
1124882446 15:33654994-33655016 GCTGCTCCCCGCCCCCAGGAAGG - Intronic
1125045522 15:35239586-35239608 ACTTGCCCCCGCCCCAGGAAAGG - Intronic
1125238189 15:37540639-37540661 ACTTCCCCCCACCCCAGGAATGG - Intergenic
1125718810 15:41835407-41835429 CCTTCCTTCTGCCCCAGGGAGGG + Intronic
1125837919 15:42770095-42770117 CCTGCCCCCCACCCCACGACAGG - Intronic
1126071811 15:44872132-44872154 CCTGCCCCCCACCCCATGACAGG - Intergenic
1126581749 15:50248425-50248447 CCTGCCCAGCCCTCCAGGGATGG + Intronic
1126617779 15:50603453-50603475 CCTGCCCCCCACCCCATGACAGG + Intronic
1126696450 15:51329952-51329974 CCAGCCCCACATCCCAGGGAGGG - Intronic
1127286465 15:57538010-57538032 GCCACCCCCCGCCCCAGGGCAGG + Intronic
1127632288 15:60838404-60838426 CCTGCCACCTGCCCCACTGAGGG + Intronic
1128146092 15:65333223-65333245 CCTGCCCTCCTCCTCAGGGTTGG + Intronic
1128212406 15:65911983-65912005 CACGCCCCCCGCCACATGGAGGG - Intronic
1128214275 15:65923464-65923486 CCTGCCAACCCACCCAGGGAGGG + Intronic
1128249013 15:66151950-66151972 CCTGCCCCCCGCCCCATGGCAGG - Intronic
1128338228 15:66802262-66802284 CCTGCCCCCCGCCACACTGGTGG - Intergenic
1128374442 15:67065470-67065492 CCCGCCCCCTGCTCCGGGGAGGG - Intronic
1128451270 15:67807155-67807177 CCTGCCCCCAGCCCTGGGGGGGG - Intergenic
1128643859 15:69360550-69360572 CCTCCCCATCGCCCCAGTGAAGG - Intronic
1128757811 15:70195388-70195410 CCTGGCTCCAACCCCAGGGATGG - Intergenic
1128841458 15:70854189-70854211 CCTGCCGCTCGGCCCAGGGGAGG + Intronic
1129742108 15:77994290-77994312 CCTGCTCCCCACCCCTTGGAAGG - Intronic
1129761298 15:78130787-78130809 CCTGCCCCCCAGCCCCAGGAAGG - Intronic
1129843375 15:78757179-78757201 CCTGCTCCCCACCCCTTGGAAGG + Intergenic
1130102378 15:80903807-80903829 TCTGCCCCCCACACCTGGGAAGG + Intronic
1130254529 15:82319803-82319825 CCTGCCCCCAGCCCCACTGGCGG + Intergenic
1130261289 15:82355751-82355773 GCGGCCGCCCGCCCCAGGGGAGG - Intergenic
1130279946 15:82513267-82513289 GCGGCCGCCCGCCCCAGGGGAGG + Intergenic
1130326941 15:82888951-82888973 CCTCCACTCCTCCCCAGGGAAGG - Intronic
1130471321 15:84229453-84229475 GCGGCCGCCCGCCCCAGGGGAGG + Intergenic
1130478815 15:84344024-84344046 GCGGCCGCCCGCCCCAGGGGAGG + Intergenic
1130492955 15:84444107-84444129 GCGGCCGCCCGCCCCAGGGGAGG - Intergenic
1130593615 15:85234080-85234102 GCGGCCGCCCGCCCCAGGGGAGG + Intergenic
1130600436 15:85270167-85270189 CCTGCCCCCAGCCCCACTGGCGG - Intergenic
1130613448 15:85381198-85381220 GCGGCCGCCCGCCCCAGGGGAGG - Intronic
1130698314 15:86153502-86153524 CCTGCCCCCCACCCCACGACAGG - Intronic
1130840776 15:87698839-87698861 CCTGCCCCCCACCCCACGACAGG - Intergenic
1131059754 15:89397472-89397494 CCTGACCCTGCCCCCAGGGAGGG - Intergenic
1131116502 15:89799381-89799403 CCTGCCCCCTGCCCCAGGACAGG - Intronic
1131262349 15:90893875-90893897 CCTCGCCCTGGCCCCAGGGAGGG + Intronic
1132087369 15:98919284-98919306 CCTGCTGCCCGCCACACGGAAGG + Intronic
1132199631 15:99942469-99942491 CCTTCCCCCCTCCCCAGAAAGGG - Intergenic
1132299999 15:100769294-100769316 CCTGCCTCCCCACTCAGGGATGG - Intergenic
1132320088 15:100919337-100919359 TCTGCCCCCCGCGCCGGGGCCGG - Exonic
1132647641 16:1006538-1006560 CCAGCCCCCAGCACCAGGGGAGG + Intergenic
1132658248 16:1050154-1050176 CCTGCCCGCAGGCCCAGAGATGG - Intergenic
1132691250 16:1182837-1182859 CCTGCACCCCATCCCAGGCAGGG - Intronic
1132711238 16:1268910-1268932 CCTGCCCCCAACCCCAGAGCCGG - Intergenic
1132802955 16:1763166-1763188 CCAGCTCCCCGCTGCAGGGAGGG - Intronic
1133233954 16:4379123-4379145 CCTGCACTCCGCCCCAGGCTGGG - Intronic
1134914787 16:18060505-18060527 CCTGGCTCCCGTCCCAGGGAGGG - Intergenic
1136282311 16:29221028-29221050 CCTGCCCCCCACTGCAGAGACGG + Intergenic
1136590795 16:31216594-31216616 CCAGCCCTTCGCCCCCGGGAGGG + Intronic
1137251967 16:46747514-46747536 CCTGCCATTCTCCCCAGGGAAGG - Intronic
1137475929 16:48810571-48810593 GCTGTCCTCCGGCCCAGGGAGGG + Intergenic
1138105412 16:54285053-54285075 CCTGCGCGCCGCCCCAGCCAGGG + Exonic
1138186572 16:54982039-54982061 CCTGCCCCCGGCTCTAGGGAAGG - Intergenic
1139750638 16:69107155-69107177 ACAGCCCCCCGCCCCAGGTCTGG + Intronic
1140218802 16:73028721-73028743 ACTGCCCCCTTTCCCAGGGATGG - Intronic
1141567372 16:84911852-84911874 CCTGCCTTCTACCCCAGGGAAGG + Intronic
1141768602 16:86074962-86074984 CCTGTCCCTGGCCCCAGAGATGG + Intergenic
1142086683 16:88186946-88186968 CCTGCCCCCCACTGCAGAGACGG + Intergenic
1142607066 17:1087793-1087815 CCTGCCCCTGGCTCCTGGGAGGG - Intronic
1142638373 17:1271232-1271254 CCTGCGATCCGCCCCCGGGATGG + Exonic
1142694658 17:1627266-1627288 CCTTGCCTCCACCCCAGGGAGGG - Intronic
1142747217 17:1965883-1965905 CCTTCCCCCCACCCCTGAGAGGG + Intronic
1142905325 17:3037271-3037293 AATGCCCCCCTCCCCAGGGCTGG - Exonic
1143030167 17:3963508-3963530 CCTCCCTCCCTCCCCAGAGATGG + Intronic
1143031941 17:3972871-3972893 CCTGCCCCTCCCCTGAGGGAAGG - Intergenic
1143186624 17:5014042-5014064 CCTTCTCCCGCCCCCAGGGAAGG - Intronic
1143204701 17:5133627-5133649 CCACCCCCCCACCCCAGGGTGGG - Intronic
1143413286 17:6725700-6725722 CCTGCCCCCCACCCCACGACAGG - Intergenic
1143485396 17:7251361-7251383 GCAGCCCCCCGCCGCCGGGAGGG + Exonic
1143777153 17:9206844-9206866 CCTGCTCTCCTCCCCAGGCACGG + Intronic
1143778809 17:9218638-9218660 CCCGCCCCCCACCCCCGGGGTGG + Intronic
1144792592 17:17869044-17869066 GCCACCCCCAGCCCCAGGGAGGG - Intronic
1145007290 17:19344841-19344863 CCAGCCCCCAACCCCAAGGAGGG + Intronic
1145196509 17:20898913-20898935 CCTCCCCCCCGCCCCCCGCAGGG - Intergenic
1145761040 17:27425645-27425667 CCTGTCCCCAGCCCCATGAAGGG - Intergenic
1146163689 17:30572820-30572842 CCTGCCCACCACCCCAAGGCCGG + Intergenic
1146906773 17:36622995-36623017 ACTGCCCCACGCCCCAGGGTGGG + Intergenic
1147184387 17:38705593-38705615 CCGGCCCCCCGCCCCAGCCCCGG + Exonic
1147254480 17:39174015-39174037 CCGGCTGCCCGCCTCAGGGATGG - Exonic
1147586599 17:41656755-41656777 CCTTCCTCCCTCCCCATGGAAGG - Intergenic
1147742029 17:42675272-42675294 CCTGTCCCCAGGCTCAGGGAAGG + Intronic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1147912223 17:43862482-43862504 CCTGCACCAAGCCCCAGAGATGG - Exonic
1148554623 17:48570837-48570859 CCTGCTCCCGGCTCCAGCGAGGG + Intronic
1148572141 17:48678585-48678607 CCTGCCGGCCGCCCGAGGGAAGG - Intergenic
1148605642 17:48927183-48927205 CCTTCCCCCCACCCCAGGGATGG + Exonic
1148664117 17:49361958-49361980 GCAGGCCCCCGCCGCAGGGATGG - Intronic
1148782463 17:50129656-50129678 CCTCACCCCCACCCCCGGGATGG - Exonic
1150124954 17:62629451-62629473 CCTGGACACAGCCCCAGGGAGGG - Intronic
1150455628 17:65304582-65304604 CCCCCCCCCCCCCCCAGAGAAGG + Intergenic
1150530454 17:65976123-65976145 CCTGCCTCTCTCCCCAGGGAGGG + Intronic
1151143146 17:72014663-72014685 CCTGCCCCCCACCCCATGACAGG - Intergenic
1151467909 17:74299649-74299671 CCTGCTCCCTGCCCTAAGGAAGG + Intronic
1151954324 17:77373099-77373121 CCTGGCCCGCGCCCAGGGGACGG - Intronic
1152544920 17:80995595-80995617 CCTGAACCCTGCCCCAGGGCCGG + Intronic
1152741558 17:82020653-82020675 CCTTCCCCCCACCCCGGGCATGG - Intronic
1152750429 17:82060082-82060104 CCTCCCCTCAGGCCCAGGGAGGG - Exonic
1152755810 17:82086553-82086575 CCTCCCTCCCTCCCCAGGGCTGG - Exonic
1152760270 17:82103860-82103882 GCTGGCCCCCTCCCCAGGGCAGG + Intronic
1152878581 17:82802659-82802681 GCTTCCCCCCTCCTCAGGGAGGG + Intronic
1152895377 17:82907882-82907904 CCTCCCACCCTCCCCAGGCAGGG + Intronic
1152926510 17:83090139-83090161 CCCCCGCCCCGCCCCAGGGTGGG + Intronic
1152926539 17:83090203-83090225 CCCCCGCCCCGCCCCAGGGTGGG + Intronic
1152926599 17:83090344-83090366 CCCACCCCCCGCCCCAGGGTGGG + Intronic
1153350628 18:4077481-4077503 CCTGCCCTCCGCCACAAGGAGGG - Intronic
1153583646 18:6599829-6599851 CCCCTCCCCCGCCCCAGGGAAGG + Intergenic
1153880410 18:9417412-9417434 CCTGCCACTGGCCCCAGGGGTGG - Intergenic
1154328434 18:13409284-13409306 GCTGCCTCCCCTCCCAGGGAAGG + Intronic
1155153901 18:23142801-23142823 CCTGCACCCCTCCCCAGGTGGGG - Intronic
1157670538 18:49524765-49524787 TCTGCCCCCCACCCTAGGGGTGG - Intergenic
1160509108 18:79443501-79443523 CCTCCCCACCCCCCGAGGGACGG - Intronic
1160514491 18:79470903-79470925 CCTGCCCCCCGCCCCAGGGAGGG - Intronic
1160616274 18:80131842-80131864 CCTGCCCCCCACCCCATGACAGG - Intronic
1160720989 19:596830-596852 CCTGCCTCTCGCCCTGGGGAGGG - Intronic
1160803448 19:980699-980721 CCTGGCCACGTCCCCAGGGAGGG + Intergenic
1160835443 19:1122629-1122651 CCCGCCCCCTGCCCCAGGCAGGG + Intronic
1160863150 19:1246006-1246028 CCTGCCCCCACCACCAGGGAGGG + Intergenic
1160865034 19:1252681-1252703 GCTGCCACCCGCCCCAGCAAGGG + Intronic
1160887988 19:1360894-1360916 CCTGGCCCCGGCCCGGGGGATGG - Exonic
1161152691 19:2717925-2717947 ACAGCCCCACGCCCCGGGGAGGG + Intronic
1161170093 19:2808226-2808248 GCTGCCTCCCTCCCCAGGGAAGG + Exonic
1161195529 19:2984142-2984164 CCTGCCACTCTCCCCCGGGAGGG + Intronic
1161221015 19:3118161-3118183 CTGGCCCCAGGCCCCAGGGAAGG - Intronic
1161327787 19:3671739-3671761 CCTGCCCCCACCCCCTGGGCAGG - Intronic
1161349224 19:3783240-3783262 CATGAGCCCAGCCCCAGGGAGGG + Intronic
1161439845 19:4284720-4284742 CCTGCCCCGCCCCCCAAGGTAGG + Intronic
1161504263 19:4635692-4635714 CCAGCCCCCGACCCCAGGGAGGG + Intergenic
1161594980 19:5146474-5146496 CCTGAGCCTCCCCCCAGGGAAGG - Intronic
1161596329 19:5152766-5152788 GCTGTCTCCTGCCCCAGGGAGGG + Exonic
1161668136 19:5589464-5589486 CCTGCCCAGCGCCACAGGGTGGG - Intronic
1161924981 19:7293674-7293696 ACCGCCCCCCGCCCCTGGGGAGG + Intronic
1162019854 19:7863407-7863429 CCGGTCCCCCGCCCCAGGTGCGG + Exonic
1162393852 19:10404998-10405020 CCCGCCCCCCAGGCCAGGGAGGG + Intronic
1163287160 19:16355945-16355967 CCTGCCCACCGCCCAGCGGAGGG + Intronic
1163315631 19:16538779-16538801 CCACCCCCCCGCCCCAGAAAGGG + Intronic
1163365453 19:16873520-16873542 CCTCCCCCCCCCCCCAGGCTGGG + Intronic
1163437207 19:17302902-17302924 CCTGCCCCCTACCCCAGGTTGGG + Intronic
1163450953 19:17377238-17377260 GCTGCCCCCCGCCCGAGCGTAGG + Exonic
1163497667 19:17656013-17656035 CCCGCCAGCTGCCCCAGGGAAGG - Exonic
1163826687 19:19528154-19528176 CCTGCCCCTCCCCACTGGGACGG + Exonic
1164630393 19:29758073-29758095 CCTGCCCTAGGCCCCAGGGGTGG + Intergenic
1164659265 19:29949052-29949074 GCTGCCCCCCGCCTCCCGGACGG + Intronic
1164804932 19:31109284-31109306 TCTGCCCCCAGCACCAGAGAAGG - Intergenic
1165102271 19:33445975-33445997 CCTGCCCCCACCACCAAGGAAGG + Intronic
1165389172 19:35528516-35528538 CTTGCCCTCCACCCCAGAGATGG + Intergenic
1166297869 19:41897510-41897532 CCATCCCCCTGCCTCAGGGAAGG + Intronic
1166313927 19:41978172-41978194 CTTGCCCACCGCGTCAGGGACGG + Exonic
1166764640 19:45245474-45245496 CCCGCCCCTGGCCCCAGAGAGGG - Intronic
1166780697 19:45341012-45341034 CATGCCCCCCACCCCAGCGCAGG + Intronic
1166887948 19:45973132-45973154 TCTGTCCCCCGCCTCGGGGAGGG + Intronic
1166997824 19:46728172-46728194 CCTGCCCACTGCCCCACGGAGGG - Intronic
1167377669 19:49120237-49120259 CCTGCCGCCGCCACCAGGGAGGG + Intronic
1167472824 19:49684905-49684927 CCTGCCTGCCTCCCCAGGGTGGG + Exonic
1167593835 19:50417537-50417559 CCTGGCCCCCTCCCCAGGGCGGG + Intronic
1168103984 19:54155597-54155619 CCTCCTCCCCTCCCCAGTGAGGG + Exonic
1168239530 19:55082193-55082215 CCCGCGCCCCGGCCCAGGGGCGG - Intronic
1168414202 19:56158633-56158655 CCAGCCCCCAGCACCGGGGAGGG + Intronic
925147294 2:1589568-1589590 CCTGGGCCCCTCCCCTGGGAAGG - Intergenic
925147991 2:1593863-1593885 CCTGCTCACAGCCCCAGGGAGGG - Intergenic
925181382 2:1819131-1819153 CCTGCCTCCTGCCCAAGGGATGG + Intronic
925404083 2:3594894-3594916 CCTGCCCCCCACCCCAAAGCCGG + Intronic
925657234 2:6162862-6162884 CCTGCCCCCCACCCCAAGACAGG - Intergenic
925920115 2:8632545-8632567 CCCGCCCCCCACCCCAGGACAGG + Intergenic
926052477 2:9753826-9753848 CCTGCCACCCGCCCCTCCGACGG + Intergenic
926292892 2:11544661-11544683 CCTGCTCTCATCCCCAGGGAAGG + Intronic
927927614 2:27024673-27024695 CTTGCCCCCTGCCCCCTGGATGG + Intronic
928112940 2:28525263-28525285 CCAGCCTCCAGACCCAGGGACGG + Exonic
929276235 2:40027786-40027808 CCTTCCCCCCACCCCAGGTCAGG - Intergenic
929396705 2:41531894-41531916 CCAGTCCCCCACCCCAGGTAGGG + Intergenic
929539844 2:42811048-42811070 GCTGCCCCTCGCCCCCGGGCGGG + Intergenic
929825549 2:45306828-45306850 CCCACCCCCATCCCCAGGGAGGG - Intergenic
930941622 2:57021406-57021428 CCTGCCCCCCACCCCATGACAGG + Intergenic
931648056 2:64443228-64443250 CCTGCCCCCCGCCCCCAGCAAGG - Intergenic
931763572 2:65436099-65436121 CCCCCTCCCCGCCCCTGGGAGGG - Intergenic
931885203 2:66609792-66609814 CCTGCCCCCCACCCCAGGACAGG + Intergenic
931885913 2:66617248-66617270 CCTGCCCCCCACCCCACGACAGG + Intergenic
932068192 2:68589156-68589178 CCTGCCTCCAGTCCCTGGGAAGG - Intronic
932699871 2:73985136-73985158 CCTGCCCGCCGCCTCCGGGGCGG - Intergenic
933415850 2:81985430-81985452 CGAGCCCCCCGCCCCAAGGTGGG + Intergenic
934567577 2:95349094-95349116 CCCGCCCCCCGTCAGAGGGAGGG + Intronic
934618150 2:95787959-95787981 CCTGCCCCCAGCCACAGGGAGGG + Intergenic
934642743 2:96036600-96036622 CCTGCCCCCAGCCACAGGGAGGG - Intronic
934915260 2:98296249-98296271 CCCTCCCACGGCCCCAGGGAAGG - Intronic
934941930 2:98509031-98509053 CCAGCCCCTCACCCAAGGGAAGG + Intronic
934991860 2:98927220-98927242 CCGTCCACCCGCACCAGGGAGGG - Intronic
935648734 2:105363855-105363877 CCTGCTCCCAGCCACAGGGCTGG - Intronic
935863213 2:107356928-107356950 CCTTCCTCCTGCTCCAGGGAAGG + Intergenic
936520632 2:113210121-113210143 CCAGCAGCCAGCCCCAGGGAGGG - Intergenic
937917288 2:127105501-127105523 CCAACCCCCCACCCCAGGGAAGG - Intronic
938258740 2:129880477-129880499 CCTGACCCCCGGCCCCGTGATGG + Intergenic
938895137 2:135742141-135742163 ACTACCCCGCGCCCCAGGGACGG + Intronic
942326128 2:174778539-174778561 CCTGCCCCTCGCCCCAGTGATGG + Intergenic
942408085 2:175676725-175676747 CCTGCTCCCAGCCCCAGAAATGG + Intergenic
942459042 2:176157137-176157159 CCTGCCCCCCGCGCCGGGCTGGG + Intronic
942875172 2:180786492-180786514 CCTGCCCCCCACCCCACAAAAGG - Intergenic
943947837 2:194090482-194090504 CCTGAGCCCCACCCCAGGGTGGG - Intergenic
944655088 2:201869372-201869394 CCTGCCCCCCACCCCATGACAGG - Intronic
946306523 2:218859744-218859766 CCTGCCCCCCGCCCCCGCCTCGG + Intergenic
946312818 2:218892401-218892423 CCTGGCCCCTACCCCAGGGGTGG + Intronic
946346984 2:219118726-219118748 CCTTAAACCCGCCCCAGGGAAGG + Intronic
946401172 2:219469098-219469120 CGTGCCTCCCACCCCAGGGCTGG - Intronic
946408639 2:219505768-219505790 ACTGGTCCCAGCCCCAGGGAGGG + Intronic
946705798 2:222457789-222457811 GCTGTCCTCCACCCCAGGGAGGG + Intronic
947119171 2:226798875-226798897 GCCGCCCCCCGCGCCGGGGAGGG + Exonic
947552602 2:231057172-231057194 CCAGCCCCCCGGCCCGGGGGTGG - Intronic
947743256 2:232494594-232494616 CCAGCCCACAGCCCCAGGGTGGG - Intergenic
947937080 2:234016493-234016515 CCTGGCCACTACCCCAGGGAAGG - Intronic
948535179 2:238640634-238640656 CCTGCACCCCATCCCAGGCAGGG - Intergenic
948796144 2:240402873-240402895 CCTGCCCCCGCTCCCAGGAAAGG + Intergenic
948816280 2:240511903-240511925 CCTGCCCCCCTCCTCCGGGAGGG + Exonic
948893996 2:240919846-240919868 CCTGCCCCCATCTCCTGGGAGGG - Intronic
948915730 2:241034338-241034360 CTTGCCCCTGGCCCCAGGGGAGG + Intronic
948975596 2:241461635-241461657 ACTGCCCCCTGCCCCTGTGAGGG - Intronic
949054691 2:241921564-241921586 CCGGCCTCCTGTCCCAGGGATGG - Intergenic
949054702 2:241921604-241921626 CCGGCCTCCTGTCCCAGGGATGG - Intergenic
949054713 2:241921644-241921666 CCGGCCTCCTGTCCCAGGGATGG - Intergenic
949054735 2:241921724-241921746 CCGGCCTCCTGTCCCAGGGATGG - Intergenic
949054760 2:241921804-241921826 CCGGCCTCCTGTCCCAGGGATGG - Intergenic
949054771 2:241921844-241921866 CCGGCCTCCTGTCCCAGGGATGG - Intergenic
949054795 2:241921925-241921947 CCGGCCTCCTGTCCCAGGGATGG - Intergenic
949054807 2:241921965-241921987 CCGGCCTCCTGTCCCAGGGATGG - Intergenic
949054829 2:241922045-241922067 CCGGCCTCCTGTCCCAGGGATGG - Intergenic
949054897 2:241922283-241922305 CCGGCCTCCTGTCCCAGGGATGG - Intergenic
949054960 2:241922489-241922511 CCGGCCTCCTGTCCCAGGGATGG - Intergenic
949059647 2:241949483-241949505 ACTCCCACCCGGCCCAGGGAGGG - Intergenic
1169080929 20:2797388-2797410 CCTGGCCCAGGACCCAGGGAAGG + Intronic
1169200474 20:3706770-3706792 CCTGCGACCTGCCCCAGAGAAGG + Intronic
1170557954 20:17530889-17530911 CCAGCCCCGCGCCGCCGGGACGG + Intronic
1172413450 20:34743467-34743489 GCTGCCCCCTGCCCCAGGAGTGG - Intronic
1172830384 20:37829102-37829124 CCTGCCCCCTGCCCCCCAGATGG - Intronic
1173235286 20:41239623-41239645 CCCACCCCCAGCTCCAGGGATGG - Intronic
1173768892 20:45640599-45640621 CCTGCCCCCCGACCTCTGGAAGG - Intergenic
1174080385 20:47967223-47967245 CCTGCCCCCAGCCCCAGCAGTGG - Intergenic
1174112498 20:48206042-48206064 CCAGCTCCCAGCCCCAGGGAAGG + Intergenic
1174137208 20:48388050-48388072 CCTGCCCCCAGCCCCAGCAGTGG + Intergenic
1174438959 20:50533441-50533463 CCTGCCCCCCGCCCCCAGCCTGG + Intronic
1174454658 20:50640626-50640648 CCTGCCCCCCTCCGCAGGGCTGG + Intronic
1174472142 20:50769096-50769118 CCTGCCCCCCTCCGCAGGGCTGG - Intergenic
1174648468 20:52105089-52105111 CCGGCCCCCAGCCCCCGGGCGGG + Intronic
1174751580 20:53116492-53116514 CCTGCCCTCCACCCCACGGCTGG + Intronic
1175267243 20:57710108-57710130 CCCGCCCCCCGGCTCGGGGAGGG - Intronic
1175836400 20:61998510-61998532 CCTGTCCCACACACCAGGGACGG + Intronic
1175846267 20:62060534-62060556 CCTGCCCCCTGCCCCGCGGCTGG - Intronic
1175900876 20:62359465-62359487 CCAGGCCCCAGGCCCAGGGAAGG - Intronic
1175910975 20:62405428-62405450 CCTGGCCGCTGCTCCAGGGAGGG - Intronic
1176070178 20:63222161-63222183 CCTCCCCCCACCCCCAGGAATGG - Intergenic
1176195734 20:63835759-63835781 CCTGGCCTCTGTCCCAGGGAAGG - Intergenic
1176297699 21:5083005-5083027 CATGGCCCCAGCCTCAGGGAGGG + Intergenic
1176380246 21:6109018-6109040 CTTGCCCACGGGCCCAGGGAAGG + Intergenic
1176428012 21:6560565-6560587 CCCGCCCCCAGCCCCAGGAGGGG - Intergenic
1179177698 21:39021154-39021176 CCCACCCCCCACCCCAAGGATGG + Intergenic
1179608203 21:42531971-42531993 CTGGCCCTCCGCCCCTGGGAAGG - Intronic
1179703503 21:43168882-43168904 CCCGCCCCCAGCCCCAGGAGGGG - Intergenic
1179726665 21:43344826-43344848 CCTGCCTGCCGCCCCCGGGTGGG - Intergenic
1179743228 21:43429220-43429242 CTTGCCCACGGGCCCAGGGAAGG - Intergenic
1179801838 21:43814898-43814920 CCTGCCTCTCGCCTCAGGCAAGG + Intergenic
1179859330 21:44178944-44178966 CATGGCCCCAGCCTCAGGGAGGG - Intergenic
1179882804 21:44300450-44300472 CCTGCCCCGCGGCCCAGAGTCGG - Intronic
1180068228 21:45423491-45423513 CCCGCCCCCCGCCCCCCGGAGGG + Intronic
1180109959 21:45643123-45643145 CCTGGGCCCCGCCCCAGCAAGGG + Intergenic
1180150645 21:45945495-45945517 CCCTCCCACAGCCCCAGGGAGGG - Intergenic
1180701476 22:17783687-17783709 CCTATCCCTGGCCCCAGGGAGGG - Intergenic
1180710026 22:17833148-17833170 CCTGCCTCCCTCCACAGGGCAGG - Intronic
1180949571 22:19715006-19715028 CCTGCGCCCCTCCCCAGGATGGG + Intronic
1180950738 22:19719376-19719398 CCTGGCCCCAATCCCAGGGAGGG - Intronic
1181031402 22:20150245-20150267 TCTGCCCCCCACCCCAGAAAAGG - Exonic
1181065560 22:20304123-20304145 CCAGCCCCTGGCCCCAAGGATGG - Intergenic
1181085511 22:20437747-20437769 CCTGCCCCGCGCCTCATGGAGGG - Exonic
1181634627 22:24168914-24168936 CCGCCCCACCGCCCCAGGGGAGG + Intronic
1182015866 22:27039238-27039260 CCTGCCCTCAGCCCCAGGGGTGG + Intergenic
1182903904 22:33920602-33920624 CCGGCCCCGCGCCCCAGGCCGGG - Intronic
1183314194 22:37128229-37128251 CCTGACGCTGGCCCCAGGGAGGG - Exonic
1184060652 22:42079197-42079219 CCTGCCCAAGGCCCCAGTGAGGG - Exonic
1184286965 22:43477320-43477342 CCTGCTCCCAGCCCCAGACAGGG - Intronic
1184523630 22:45009360-45009382 CTCGCCCCCCGCCCCCGGGCAGG + Intronic
1184680735 22:46071186-46071208 CCCGCCGCCCGCCCCGGGCAAGG - Intronic
1185056132 22:48579252-48579274 CCTGCCCACCGCACCAGGCCTGG + Intronic
1185077064 22:48689283-48689305 TCTGACCCCCACCCCAGAGATGG + Intronic
1185116149 22:48939551-48939573 GCTCCCCTCCGCTCCAGGGATGG + Intergenic
1185152042 22:49169368-49169390 CCTGTCTCCAGGCCCAGGGATGG + Intergenic
1185275297 22:49948033-49948055 CCTGCACCCCTCACCAGGGCGGG - Intergenic
1185277442 22:49955895-49955917 CCTGGCCCCCGGCCCAGGCCTGG + Intergenic
1185377231 22:50488157-50488179 CCTGCTCCCCAACCCAGGCAGGG - Intronic
949540711 3:5030007-5030029 CCTGCCCCCACCCCCAGTAAAGG - Intergenic
950125398 3:10507028-10507050 TCAGCCCCCAGCCCCATGGAAGG + Intronic
950204821 3:11071307-11071329 CCTGCCCCCCTCCCCACTGTGGG - Intergenic
950584044 3:13880261-13880283 CCTGCACCCCGGAGCAGGGAGGG - Intergenic
950690614 3:14652896-14652918 CCCGCCCCCCGCCCCTTAGACGG - Intronic
950867353 3:16199765-16199787 GCTGCCCCCAGCCCCAGTCATGG - Intronic
953609586 3:44436500-44436522 CCTGCTCACCCACCCAGGGAGGG - Intergenic
953641585 3:44712789-44712811 CCAGCCCGCCGCCCCAGCAATGG - Intronic
954792806 3:53145468-53145490 CCTGCAGCTCACCCCAGGGAGGG - Intergenic
954871258 3:53769169-53769191 CCCAACCCCCACCCCAGGGAGGG - Intronic
955895973 3:63700219-63700241 CCTGGCCCCCACCCCAGGACAGG - Intergenic
956113728 3:65897461-65897483 CCTGCCCCCCACCCCACAGCAGG - Intronic
956590693 3:70911593-70911615 CCTGCCCCCCACCCCACGTTTGG - Intergenic
957915434 3:86682539-86682561 CATGCCTCCCTCCACAGGGATGG - Intergenic
958641534 3:96813498-96813520 CGCGGCCCCCGCCCCAGGGCCGG - Intergenic
960054500 3:113267575-113267597 CCTGCCCCCAGCCCCAAGGAAGG + Intronic
960276213 3:115732306-115732328 CCTGCCCCCCACCCCATGACAGG + Intergenic
960912913 3:122667312-122667334 CCTGCCCCCCACCCCACGACAGG + Intergenic
960992242 3:123319569-123319591 CATGCCCCCAGCACCACGGAAGG - Intronic
961305617 3:125958069-125958091 CCCGCCCCCCCCCCCAGGGCGGG + Intergenic
961361551 3:126371202-126371224 CCTGCGCCCAGCCCAAGGGCAGG + Intergenic
961368252 3:126414801-126414823 CCTGCCCCACGTGCCAGGCATGG + Intronic
961654792 3:128435315-128435337 ACTGCCCTCTCCCCCAGGGAGGG + Intergenic
961786530 3:129350388-129350410 CCTGCCCCCCAGGCCAGGGGTGG - Intergenic
962282699 3:134064334-134064356 ACTGCCCCCCACCCCAGGAGGGG + Intergenic
962480035 3:135790032-135790054 CCTGCCCCCCACCCCATGACAGG + Intergenic
966919441 3:184602282-184602304 CCTGCCCCCCGTCCCAGCGAGGG - Intronic
967596181 3:191329165-191329187 CCTGCCCCCCTCCTACGGGAGGG - Exonic
967865309 3:194185427-194185449 CCTGCCTCTTGCCCCAGAGATGG + Intergenic
967965013 3:194954175-194954197 TCCGCCCCCTGCCCCAGGAATGG + Intergenic
968512732 4:1002665-1002687 GCCGCCCCCCGACCCAGGGCCGG - Intronic
968542983 4:1177751-1177773 CCTGTGCCGCGCCCCAGGGAGGG - Intronic
968927591 4:3557905-3557927 CCTGGCCCCTGCCCCTGGGGAGG + Intergenic
969310158 4:6348275-6348297 CCTGCACCCCACCCCAGTGAGGG + Intronic
969642733 4:8408884-8408906 CCACCCCCCCCCCCCAGTGAGGG - Intronic
970372916 4:15426208-15426230 CCTGCCACTCACCCCAAGGACGG - Intronic
970972952 4:22006019-22006041 CCTGTCCTCCGCCTCATGGAAGG + Intergenic
971282023 4:25249439-25249461 GCTGCCCCCCGCCTCCCGGATGG + Intronic
971282044 4:25249481-25249503 GCTGCCCCCCGCCTCCCGGACGG + Intronic
972691819 4:41406512-41406534 CCTCCCTCCCTCTCCAGGGAGGG + Intronic
974264376 4:59565456-59565478 CCAGCCCCCCGCCCCATGACAGG + Intergenic
975623320 4:76315901-76315923 CCTCCCCCTCCCCCAAGGGATGG - Intronic
980557773 4:134431263-134431285 CCTGCCACCCTCCACAGGGATGG + Intergenic
982065983 4:151654847-151654869 TCTGCCTCCCGTCCCAAGGATGG + Intronic
982116067 4:152099335-152099357 CCTTCCCCCTGAACCAGGGAGGG - Intergenic
984180902 4:176481116-176481138 TCTGCCTCCAGCCCCAGGTATGG + Intergenic
985008827 4:185561794-185561816 CCTGCACCCTGCCCCAGGACTGG + Intergenic
985515489 5:342802-342824 CCTGCCACCCACCTCAGAGAGGG - Intronic
985794010 5:1948932-1948954 CCTGCTCCGTGCGCCAGGGACGG + Intergenic
986139635 5:5017659-5017681 CCTGACCACCGCCACAGGGGAGG + Intergenic
987529643 5:19101083-19101105 CCTGCCCCCCACCCCATGACAGG - Intergenic
989273321 5:39557202-39557224 CCTGCCCCCCACCTCAGATAGGG - Intergenic
989368325 5:40680078-40680100 GCTGCCCTCCGCCCCAGCCACGG - Exonic
991967240 5:72105693-72105715 CCTGCCCCTCACCCCAGTTATGG + Intergenic
992612699 5:78520834-78520856 CCTGCCCCGGGCCGCAGAGATGG + Intronic
992716169 5:79513745-79513767 CCTGCCCCCAGCTCCAGGGCGGG + Exonic
993386784 5:87270350-87270372 CCTTCCCCCCACCCCAGAGATGG + Intronic
994405097 5:99335133-99335155 CCTGCGCTCAGCCTCAGGGAGGG - Intergenic
995224819 5:109690198-109690220 CCTGCCGCCCTCCCCGGGGTCGG - Exonic
997163601 5:131635110-131635132 CCTTTCCCCCGCCCCAAGGAGGG + Exonic
997282273 5:132656537-132656559 CCTGCCCACCGCTCCCGGCAGGG + Intronic
997372012 5:133368058-133368080 TTTGCCCCCTGCCCCTGGGAGGG + Intronic
998041066 5:138951382-138951404 CCTGCCCTGAGGCCCAGGGAAGG + Intronic
998323616 5:141257833-141257855 CCTGCCCCCCACCCCATGACAGG + Intergenic
998374181 5:141680498-141680520 CCTGCCCCTCCCCCCAGCAATGG - Exonic
998385166 5:141753317-141753339 ACCACCCCCCGCCCCGGGGAGGG - Intergenic
999767977 5:154755415-154755437 CCTCCCCCCCGCCCCCGGGGCGG - Intronic
1000423890 5:161068328-161068350 CCTGCCCCCCACCCCAGGACAGG + Intergenic
1001365296 5:171132235-171132257 CCTACCCCCCACCCAAGGGAAGG + Intronic
1001412409 5:171520536-171520558 CCTGCCCAAGGCCCCATGGAGGG - Intergenic
1001425410 5:171619239-171619261 TCCACCCCCAGCCCCAGGGAGGG + Intergenic
1001646050 5:173283207-173283229 CCTGCTCCCTGCCCTAGAGAGGG + Intergenic
1001705281 5:173737079-173737101 TCTTCCCCCAGCCCCAGGGGTGG - Intergenic
1002082249 5:176744024-176744046 CCTGCCCCGGCCCCCCGGGACGG - Intergenic
1002350182 5:178577608-178577630 CCTGCCCCCCGCTGCCTGGATGG + Intronic
1002773315 6:307619-307641 CCCACCCTCCGGCCCAGGGAGGG - Intronic
1003180013 6:3783209-3783231 CCTGCACCCAGCCCCAGGGAGGG - Intergenic
1003873921 6:10420876-10420898 CCTCCACCCCACCCCTGGGAAGG - Intergenic
1004075333 6:12339660-12339682 CCTGCCCTCTGCCCCAGGTGAGG - Intergenic
1004502986 6:16225711-16225733 CCTGCCCCCCACCCCACGACAGG - Intergenic
1005898277 6:30196485-30196507 CCTGGCGCCCTGCCCAGGGACGG + Intronic
1006863163 6:37187216-37187238 CCCACCCCAGGCCCCAGGGAAGG - Intergenic
1006929649 6:37680121-37680143 CCCCACCCCCGCCCCCGGGAGGG - Intronic
1007259832 6:40555720-40555742 CCTGCCCCCACCCCCATGGCAGG + Intronic
1007952932 6:45888140-45888162 AATCCCCCCCACCCCAGGGAAGG - Intergenic
1008932609 6:56955417-56955439 CCTGCGCCCCGCCCCGAGGTTGG + Exonic
1011490839 6:87890263-87890285 CCTGCCCCAGTCTCCAGGGAAGG - Intergenic
1011719534 6:90141183-90141205 ACTGCTCCCCCACCCAGGGATGG + Intronic
1012416606 6:99020112-99020134 TATGACGCCCGCCCCAGGGATGG + Intergenic
1012910270 6:105110059-105110081 CCTGCTCCTCGCCCCAGGAGGGG - Intronic
1013190554 6:107801433-107801455 CCTGCCCCCCACCCCAGGTATGG + Intronic
1013619372 6:111873134-111873156 GCCGCCGCCCGCGCCAGGGAGGG - Exonic
1013650265 6:112187845-112187867 CCTTCTCCCCACCCCAGGGAGGG + Intronic
1014462155 6:121708918-121708940 CCTGCCCCCCACCCCATGACAGG - Intergenic
1015155375 6:130089214-130089236 CCTGCCCCCCACCCCATGACAGG + Intronic
1016038998 6:139412480-139412502 CCTGCCCCTCACCCCAGGACAGG - Intergenic
1016295012 6:142564708-142564730 CCTGCCCCCCACTTCAGTGAGGG - Intergenic
1017303239 6:152886496-152886518 CCTGCCCCCCACCCCATGACAGG - Intergenic
1017416775 6:154229078-154229100 TCTGCCTCCAGCCCCAGGGGCGG + Intronic
1017720615 6:157240905-157240927 CCTCCCTCCCTCCCCAGGGCTGG - Intergenic
1017852527 6:158317314-158317336 CCTGCCCCCCACCCCACGACAGG + Intronic
1018498131 6:164371025-164371047 CCACCCCCCCACCCCAAGGATGG - Intergenic
1018551625 6:165004617-165004639 CCTGCCCCAGGCCCCAAGCAAGG - Intergenic
1018551832 6:165006928-165006950 CCTGCCCCAGGCCCCAAGCAAGG - Intergenic
1018838653 6:167503654-167503676 CTCGGCCCCCACCCCAGGGAGGG - Intergenic
1018923476 6:168191347-168191369 CCTGCCCCTCGCCCTTGGGCAGG + Intergenic
1019067024 6:169311013-169311035 CCTGGCCCCTGCCCCATGGAAGG - Intergenic
1019281675 7:203423-203445 CCTGCCCTCCCACCCAGGAAGGG - Intronic
1019328731 7:452461-452483 CCGGCCCCACGCCCCAGGGAGGG + Intergenic
1019461400 7:1160723-1160745 GCTGCCCCCCGCCCCCTGGACGG + Intronic
1019557824 7:1641366-1641388 CCTGCCCCCTGCCCCATGTGTGG + Intergenic
1019627861 7:2030196-2030218 CCCGCCCCGCGCTCCACGGAAGG + Intronic
1019711510 7:2520141-2520163 GCTGCCCCCCGCCCCGCCGACGG + Exonic
1019748298 7:2712843-2712865 TCGGCCCCCCGTCCCTGGGATGG + Exonic
1019772380 7:2891712-2891734 CCTCCCCCCCTCCCCTGGTATGG - Intergenic
1020023711 7:4883883-4883905 CCTGCCGGCCGCCCAATGGACGG + Intergenic
1020141252 7:5613065-5613087 CCTGCCCACAGCCCAAAGGACGG - Intergenic
1020282798 7:6658851-6658873 CCTGCCCCCAGCTCCAGGAAGGG + Intergenic
1021749864 7:23785837-23785859 CCTGCCCCCCACCCCATGACAGG - Intronic
1021802028 7:24316763-24316785 CCAGCCCCCCTGCCCAGGAAAGG + Intergenic
1021839811 7:24713458-24713480 CCTGAACCCCGTCACAGGGAAGG + Intronic
1022347838 7:29534395-29534417 CCTGCCCCCCACCCCATGACAGG - Intergenic
1022474205 7:30699699-30699721 CCTGCCCCCTCACCCAGGCACGG + Intronic
1022877330 7:34548170-34548192 CCTGCCCCCCACCCCATGACAGG + Intergenic
1023793575 7:43772479-43772501 CTTCCCCCCTGCCCCAGGGCTGG + Intronic
1023834366 7:44059666-44059688 CCTGGCCCCAGCCCCAGTGTAGG - Intronic
1024009045 7:45252342-45252364 CCAGAACCCAGCCCCAGGGATGG + Intergenic
1024567895 7:50697820-50697842 CCCCCACCCCACCCCAGGGAGGG + Intronic
1025899396 7:65731810-65731832 CCTTGGCCCCGCCCCAGGGTAGG + Intergenic
1026057546 7:66997631-66997653 CCACCCCCCCGCCCCCGAGATGG + Intronic
1026589688 7:71684143-71684165 CCTGCACCCAGGCCCAGGGTGGG + Intronic
1026827504 7:73593730-73593752 CCTGCTCCACCCCCCAGGGAAGG + Exonic
1027140125 7:75650830-75650852 GCTGCCACCCTCCCCAGGGCGGG - Intronic
1031905583 7:127456933-127456955 CCTGCCCCCCACCCCACGACAGG - Intergenic
1032263793 7:130356484-130356506 CCTTCCCCCAGCCCCAGGAATGG + Intronic
1032562319 7:132905091-132905113 CCTGCCCCCCACCCCACGACAGG - Intronic
1033054908 7:138042049-138042071 CCTGCCCCCCACCCCACGAAAGG - Intronic
1033339261 7:140479214-140479236 CCTCCGCCCGCCCCCAGGGACGG + Exonic
1033477038 7:141701760-141701782 CCCGCACCCCGCACCAGGGCCGG - Intronic
1034405708 7:150901252-150901274 CCTGCCCCCAGCTCCAGAGCAGG + Intergenic
1034424346 7:151006810-151006832 CCCAGCCCCAGCCCCAGGGACGG - Intronic
1034890803 7:154837525-154837547 CCTGCCCCCACCCCCAGAGCTGG - Intronic
1035319148 7:158017357-158017379 CATCCTCCCCTCCCCAGGGAGGG - Intronic
1036564100 8:9923498-9923520 TCTGCCCCACACCCCAGGGGTGG + Intergenic
1036650304 8:10637944-10637966 CCTGCCTGCAGCCCCAGGGCTGG + Intronic
1036760928 8:11508087-11508109 CCTGCCCACTGGCCCAGGGCTGG + Intronic
1037526222 8:19727085-19727107 CCTTCCCTCAGCCCCAGGAATGG - Intronic
1037689715 8:21171817-21171839 CCTGTTCTCAGCCCCAGGGATGG + Intergenic
1038221188 8:25609518-25609540 CCTGCCCCCCGCCCCACAACAGG + Intergenic
1038506997 8:28092974-28092996 CCTGCCCCGGGTCTCAGGGATGG - Exonic
1038510858 8:28134102-28134124 CCTGCCCCCCACCCCACGACAGG + Intronic
1038535452 8:28349970-28349992 CGTGCCCCGTGCCCAAGGGATGG + Intronic
1038811429 8:30849892-30849914 TCTGCCCCCAGCCCCCGAGATGG - Intronic
1038855218 8:31323802-31323824 CCTGCCCCCAACCCCACGGCAGG + Intergenic
1039072550 8:33659961-33659983 CCAGCCCCCAGCTCCAGGGCTGG - Intergenic
1039917742 8:41872306-41872328 CCAGCCGCCCACCCCAGGGCTGG + Intronic
1042803439 8:72745739-72745761 CCTGCTGCCCTCCCCAGAGATGG + Intronic
1044707809 8:95025220-95025242 GCTTCCCGCCGCGCCAGGGAAGG - Intronic
1045316066 8:101044670-101044692 CATGCCCCCCACCCCTAGGAAGG - Intergenic
1045871097 8:106927867-106927889 CTTGCCCCCCACCCCACGGCAGG + Intergenic
1046293098 8:112187867-112187889 CCTTCCCCCCGCCCCATGACAGG - Intergenic
1048149265 8:131877845-131877867 CCTGCCCCCCACACCAGGACAGG + Intergenic
1049221851 8:141432091-141432113 CATGCACCCCGGCCCAGGGTGGG - Exonic
1049266810 8:141671936-141671958 CCTGCCTCCCTCTCCTGGGAGGG + Intergenic
1049320530 8:141993827-141993849 CCTTCCCCCAACCCCAGAGAGGG + Intergenic
1049404725 8:142447322-142447344 CCTCAGCCCCTCCCCAGGGAGGG - Intergenic
1049471213 8:142775782-142775804 CTAGCCCCCTGCCCCGGGGAAGG - Intronic
1049532150 8:143160072-143160094 CCGGCCCCCCAGCCCAGGGGTGG - Intronic
1049543883 8:143220711-143220733 CCTGCCCCCTGCCTCAGGCTAGG + Intergenic
1049548837 8:143247023-143247045 CCTGCCTCCGGCCCCCGCGAGGG + Intergenic
1049656611 8:143801798-143801820 TCTGCCCCCAACACCAGGGAGGG + Intronic
1049769851 8:144374712-144374734 CCCGCCCGCCGCCTCAGGGCAGG - Intronic
1052081329 9:24209747-24209769 CCTCCCCGCCACCACAGGGATGG + Intergenic
1052973880 9:34398152-34398174 CCTTGCCCACACCCCAGGGAGGG + Intergenic
1052974389 9:34400667-34400689 CCTGCCCCGCTTCCCAGGGCTGG - Exonic
1053479511 9:38405581-38405603 CCTGCCCTCTCCTCCAGGGACGG - Intergenic
1054274210 9:63052597-63052619 CCCCCCCCCCGCCCCCGGGCAGG + Intergenic
1054400631 9:64712372-64712394 CCCCCCCCCCGCCCCCGGGCAGG - Intergenic
1054434237 9:65196687-65196709 CCCCCCCCCCGCCCCCGGGCAGG - Intergenic
1054810000 9:69427027-69427049 CATGCCCCCGGCAGCAGGGAGGG + Intergenic
1056454408 9:86746167-86746189 CATGCCCCCACCCACAGGGATGG - Intergenic
1057784695 9:98078007-98078029 CCTGCCCTCGGCCACAGGAAAGG - Intronic
1058908169 9:109498108-109498130 TCCGCCGCGCGCCCCAGGGACGG + Intronic
1059383110 9:113943811-113943833 CCTGACCACCGGCACAGGGAAGG - Intronic
1060148018 9:121268503-121268525 CCTCGACCCCGCCCCCGGGATGG + Intronic
1060406577 9:123375891-123375913 CCCCCACCCCGCCCCAGGAAGGG - Intronic
1060793809 9:126501896-126501918 ACTGCACCCAGCCCCAGGGAGGG - Intronic
1060892760 9:127199091-127199113 CCTGAGCACCGCCCCTGGGAGGG - Intronic
1061033178 9:128099109-128099131 CCTCACCCCCACACCAGGGACGG - Intronic
1061166685 9:128926905-128926927 CCTGTCCCCAACCCCAGGCATGG - Intronic
1061235723 9:129341590-129341612 CCCGCCTCCAGCCCCAGGGGAGG + Intergenic
1061657168 9:132101192-132101214 CCTGCCCCCCACCCCATGACAGG - Intergenic
1062033376 9:134372024-134372046 TCTCCTCCCCTCCCCAGGGAGGG - Intronic
1062162450 9:135087788-135087810 CCTTCCCCGGGCGCCAGGGAAGG - Exonic
1062315785 9:135966463-135966485 CCTGCCCCCTGCCCCCCGGCTGG + Intergenic
1062334013 9:136057014-136057036 CCAGCCCCCACCCCCAGGGTGGG + Intronic
1062361075 9:136188425-136188447 CCCGCCCCCGGCCCCAGGGTTGG - Intergenic
1062361908 9:136192378-136192400 CCAGCCCCCCTCCCCAAGGGTGG - Intergenic
1062396123 9:136353590-136353612 GCTGGCCCCAGCCTCAGGGAAGG + Intronic
1062413220 9:136434967-136434989 GCTGCCCCCAGCCCCAAGCAAGG + Intronic
1062458775 9:136654194-136654216 CCAGCCCACCACCCCCGGGAGGG + Intergenic
1062463186 9:136670350-136670372 CCTGCCCGCCTCCCCAGGCCAGG - Intronic
1062482939 9:136760770-136760792 CCTGGCTCCCTCCCCAGGGCAGG - Intronic
1062518067 9:136945912-136945934 CCTCCCCGCCCCCCCAGGGATGG + Exonic
1062581228 9:137230126-137230148 GCTGCCCCGCACCCCAGGGCAGG + Intergenic
1062587018 9:137254036-137254058 CCTGCCCTCCTACCCAGGGTCGG + Intergenic
1062696585 9:137878866-137878888 CCTGCCCCCATCCCTAGGGGCGG - Intronic
1185836055 X:3346613-3346635 CCTCACCCCCGGCCCCGGGAAGG - Exonic
1186356717 X:8799272-8799294 TCTGCAGCCAGCCCCAGGGAGGG - Intronic
1186357045 X:8800387-8800409 TCTGCAGCCAGCCCCAGGGACGG - Intronic
1186968602 X:14815163-14815185 CCTGCCCCCCACCCCAAGACAGG - Intergenic
1190470701 X:50776144-50776166 GCTGCCCCTCGCCCCAGTGTTGG - Intronic
1192162126 X:68796308-68796330 CCTGCCCCTGAACCCAGGGAAGG + Intergenic
1193280950 X:79650371-79650393 CCTGCCCCCCACCCCACGACAGG + Intergenic
1193755139 X:85399505-85399527 CCCCCCCCCCGCCCCAGTAAAGG - Intergenic
1194000653 X:88424719-88424741 CCTGCCCCCTGCCCCTGCCAGGG - Intergenic
1194459749 X:94151733-94151755 CCTGCCCCCCGCCCCATGACAGG + Intergenic
1194459798 X:94152139-94152161 CCTGCCCCCCACCCCATGACGGG - Intergenic
1194549964 X:95285480-95285502 CCTGCCCCCCACCCCATGACAGG + Intergenic
1194880237 X:99242073-99242095 CCTGCCCCCCGCCCCCATCAAGG + Intergenic
1195728713 X:107943712-107943734 CCTGCCCCCCACCCCATGACAGG + Intergenic
1199813133 X:151370802-151370824 TCTGCCCTATGCCCCAGGGAGGG + Intergenic
1199911272 X:152289664-152289686 CCTGCCCCCCACCCCACGACAGG + Intronic
1200955338 Y:8938562-8938584 CCTGATCCCTGCCCCAGGGGAGG - Intergenic
1201460036 Y:14212212-14212234 CCAGCCCCCCACCCCACGAAAGG - Intergenic