ID: 1160515253

View in Genome Browser
Species Human (GRCh38)
Location 18:79476010-79476032
Sequence TCCAGAAGGGGGGTGGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 609
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 559}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160515243_1160515253 -1 Left 1160515243 18:79475988-79476010 CCTGGGGCTGGGCGAGTCTGGCT 0: 1
1: 0
2: 2
3: 33
4: 254
Right 1160515253 18:79476010-79476032 TCCAGAAGGGGGGTGGGGCCGGG 0: 1
1: 0
2: 1
3: 48
4: 559
1160515233_1160515253 27 Left 1160515233 18:79475960-79475982 CCACAGGGCTCAGCATCCGACGG 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1160515253 18:79476010-79476032 TCCAGAAGGGGGGTGGGGCCGGG 0: 1
1: 0
2: 1
3: 48
4: 559
1160515239_1160515253 11 Left 1160515239 18:79475976-79475998 CCGACGGGCGCACCTGGGGCTGG 0: 1
1: 0
2: 1
3: 9
4: 161
Right 1160515253 18:79476010-79476032 TCCAGAAGGGGGGTGGGGCCGGG 0: 1
1: 0
2: 1
3: 48
4: 559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160515253 Original CRISPR TCCAGAAGGGGGGTGGGGCC GGG Intronic
900104358 1:976039-976061 TCCAGGAGGGGGGCGTGTCCTGG - Exonic
900206300 1:1433307-1433329 TCCCAAAGGCGGGTGGGGGCAGG + Intergenic
900528710 1:3142166-3142188 TCCAGGAAGAGGTTGGGGCCAGG + Intronic
900653113 1:3740910-3740932 TCCAGAAGGTGCCTGGGCCCGGG - Intergenic
900658670 1:3772482-3772504 TCCAGAAGGGGCTGGGGGCGGGG - Intergenic
900658712 1:3772578-3772600 TCCAGAAGGGGCCGGGGGCGGGG - Intergenic
900773098 1:4561479-4561501 TCCGGCAGAGGGGTGGGGGCAGG + Intergenic
900991853 1:6101734-6101756 TTTAGAATGGGGGTGGGGGCTGG - Intergenic
901065023 1:6490394-6490416 TCCGGACGGGGGGTGGGACTAGG - Intronic
902368100 1:15990367-15990389 CCTAGAAGTGGGGTCGGGCCAGG - Intergenic
902518059 1:17000371-17000393 GCCATAAGGTGGGTGGGGACGGG - Intronic
902545886 1:17190196-17190218 TCGGGAGTGGGGGTGGGGCCAGG + Intergenic
902557229 1:17254111-17254133 TCCAGTGGTGGGGTGGGGCAGGG + Intronic
902622767 1:17660096-17660118 TGCAGCAGGGTGCTGGGGCCCGG + Intronic
903526739 1:23996413-23996435 TCTAGAATGGGGGTTGGGGCAGG - Intergenic
904074355 1:27829135-27829157 TCCAGGAGGGAGGTGGGGGGGGG + Intergenic
904369584 1:30040069-30040091 TCCAGGAGGGACCTGGGGCCTGG + Intergenic
904662352 1:32094753-32094775 AGCAGAAGGTGGGTGAGGCCTGG - Intronic
904676122 1:32200363-32200385 GTCAGAAAGGGGGTGGGGCGGGG - Intergenic
905247574 1:36625629-36625651 TGCAGTAGGGGAGTGGGGACAGG - Intergenic
905411018 1:37767951-37767973 TGCAGAAGGGTGGAGGGGCCTGG + Intergenic
905960107 1:42035962-42035984 GCCAGGAAGGGGGCGGGGCCCGG - Intergenic
906177844 1:43791172-43791194 TACAGAAGGGGAGTGGGTACTGG - Intronic
906204002 1:43977259-43977281 TCCAGAAGGAGGGTAAGGCTAGG - Intronic
909340625 1:74527598-74527620 TCCAGAAGGAGGTAGAGGCCAGG + Intronic
909358857 1:74739601-74739623 GCCAGAAGGAGGCTGGGGCCAGG + Intronic
909474320 1:76065019-76065041 TCCAAAATGGGTGTGGGGCAGGG - Intergenic
909496587 1:76285908-76285930 TCCAGATGGGGGAGGGGGCGCGG - Intronic
910457459 1:87412603-87412625 TCCTGAAGGGAGGAGGGGTCTGG + Intergenic
912810171 1:112788087-112788109 TCAATATGGGGGGTGGGGCCTGG - Intergenic
912863519 1:113236519-113236541 TCTAGAAGGAGGGTGTGGCCAGG + Intergenic
912879042 1:113390724-113390746 TCCAGAAGGGGCTTCGGGCGGGG - Intergenic
913472348 1:119201807-119201829 ACCTGATGGGGGGTGGGGACTGG + Intergenic
915101261 1:153502552-153502574 CCCACATGGGTGGTGGGGCCTGG - Intergenic
915118149 1:153612975-153612997 TCCAGCAGGGCTCTGGGGCCTGG + Intronic
915249438 1:154577850-154577872 CCCAGAAGGGAGGCAGGGCCAGG - Exonic
915729345 1:158042154-158042176 ACCAGAATGGAGGTGGGCCCAGG + Intronic
916418314 1:164612752-164612774 TCCAGAAGGGGAGAGGGACCAGG - Intronic
916459686 1:165010612-165010634 TCCAGCATCGGGGTGGGGCGGGG - Intergenic
916606771 1:166350717-166350739 GCCAGAAAGGGGGTGGAGCTCGG - Intergenic
917557343 1:176103339-176103361 TCCAGGAAGCGGGTGAGGCCTGG + Intronic
917794596 1:178523840-178523862 TCCAGAAGTGGGGAAAGGCCAGG - Intronic
918304422 1:183233107-183233129 TGCAGAAGGGAGGTGAGGCAGGG - Intronic
919848083 1:201654241-201654263 TCTAGAAGGGGCCTGTGGCCTGG - Intronic
919978158 1:202626234-202626256 TGCAGAGGGAGGGTGGGGGCTGG - Intronic
920092352 1:203463724-203463746 TCCGGATGAGGGATGGGGCCTGG + Intergenic
920123068 1:203673212-203673234 ACAAGAACGGAGGTGGGGCCTGG - Intronic
920374323 1:205499252-205499274 TGAAGGAGGGGTGTGGGGCCTGG + Intergenic
920401766 1:205680538-205680560 GCCAGGAGGGGGGCGGGGCGAGG + Intergenic
920492295 1:206426096-206426118 TCAAGAAGTGAGGTTGGGCCAGG - Intronic
920854436 1:209651644-209651666 TCGACAAGAGGGGTGGGGCTGGG + Intronic
921007724 1:211111542-211111564 CCCAGACGGGGCGGGGGGCCGGG - Intronic
921157527 1:212450062-212450084 TCCAGGATAGGGCTGGGGCCTGG - Intergenic
922419446 1:225449660-225449682 TCCAGAGAGAGGGAGGGGCCGGG - Intergenic
922560661 1:226567135-226567157 GCCAGTAGGGTGGTGAGGCCGGG + Intronic
922746613 1:228047918-228047940 TCCAGGGCTGGGGTGGGGCCTGG - Intronic
923785088 1:237058788-237058810 TGGAGAAGGGGCGGGGGGCCGGG + Intronic
924588467 1:245380685-245380707 TCCAGAGAGGGGCTGGGGCAGGG - Intronic
1064323753 10:14330028-14330050 TTCAGACAGGAGGTGGGGCCCGG - Intronic
1064362832 10:14681208-14681230 TGCTGAAGAGGGGTAGGGCCAGG - Intronic
1064430524 10:15266568-15266590 CTCAGAAGGGAGGTGAGGCCAGG + Intronic
1064661375 10:17611290-17611312 TCAAGAAGAGGGCTTGGGCCGGG - Intronic
1064849743 10:19697387-19697409 TCCATAATGGGGGCGGGGGCGGG - Intronic
1065121995 10:22539187-22539209 GCCAGGAGGGGGCTGGGTCCGGG + Intronic
1065773093 10:29095691-29095713 TCAAGAATGGTGGTGCGGCCAGG - Intergenic
1067056947 10:43058053-43058075 TGGAGAAGGAGGGAGGGGCCTGG - Intergenic
1067435278 10:46272584-46272606 CCCAGAAGGGGAGTGGGGTTTGG - Intergenic
1068343321 10:55737714-55737736 GCCAAAAGGTGGATGGGGCCAGG - Intergenic
1068520632 10:58073461-58073483 CTCAGAAGGAGGGAGGGGCCAGG - Intergenic
1068786709 10:60983828-60983850 GCCAGAAGGAGGGCGGGGCCGGG - Intronic
1069708326 10:70473220-70473242 TGCAGAGTCGGGGTGGGGCCAGG - Intergenic
1069959251 10:72070060-72070082 TGCAGGTGGGGAGTGGGGCCTGG - Intronic
1069982297 10:72260934-72260956 TCCCGAGGGTGGGCGGGGCCAGG + Intergenic
1070029417 10:72662493-72662515 ACTGGAATGGGGGTGGGGCCAGG - Intergenic
1070129777 10:73648121-73648143 ACAAGAAGGGGGGTGGGGCGGGG + Exonic
1070151965 10:73811028-73811050 GCCAGACGGGGGCCGGGGCCGGG + Intronic
1070735826 10:78863091-78863113 TGCAGCAGGGAGGTGGGACCTGG - Intergenic
1071342047 10:84658329-84658351 TCCAGAAATGGGGTGGGTCTGGG + Intergenic
1071787353 10:88916565-88916587 CCCAGCAGGGGGGTGTGTCCAGG - Intronic
1073049210 10:100656756-100656778 GCCAGAAGGCCGGTGGGGCGGGG - Intergenic
1073594333 10:104785081-104785103 TCCAGGAGGGAGGTGGGGGGGGG - Intronic
1073670338 10:105580233-105580255 TGCAGTAGGGAGGTGGGGCTGGG - Intergenic
1074126027 10:110529697-110529719 TGCAGGTGGGGGGTGGGGCATGG + Intergenic
1074785287 10:116834097-116834119 TGCTGAATGGGGGAGGGGCCTGG - Intergenic
1075629307 10:123991665-123991687 GCCAGCCGGGGGGAGGGGCCGGG + Intergenic
1076289598 10:129334891-129334913 TCAGGAAGGCTGGTGGGGCCAGG - Intergenic
1076716474 10:132366782-132366804 TGCAGATGGGGTGTGGGGACAGG - Intronic
1076811572 10:132888973-132888995 TCCAGAGGGTGGGTGGAGGCGGG - Intronic
1076850886 10:133092130-133092152 TTCAGGAGGTGGGAGGGGCCCGG + Intronic
1076880235 10:133236352-133236374 GCCAGGAGGGGTGGGGGGCCAGG - Intergenic
1077018227 11:406317-406339 TCCAGTTGGGGAGTGGGGCTGGG + Intronic
1077029157 11:455954-455976 GCAAGGCGGGGGGTGGGGCCCGG - Intronic
1077164411 11:1128743-1128765 TCCAGAGGGGGGCCGAGGCCTGG + Intergenic
1077225079 11:1436127-1436149 TGATGAAGGTGGGTGGGGCCGGG + Exonic
1078513394 11:12003367-12003389 ACCAGAAGGGGTGTGGACCCCGG - Intronic
1078580580 11:12536654-12536676 TGGAGCAGGGGAGTGGGGCCAGG - Intergenic
1078845222 11:15114239-15114261 TCCAGGACGGGGGTGGGGGGTGG + Intronic
1079373607 11:19872711-19872733 TCCAGCAGGCGGGTCGGGGCAGG - Intronic
1079659261 11:23019241-23019263 TCAAAAAGGTGGGTGTGGCCAGG + Intergenic
1080436363 11:32248686-32248708 TCCAGATGTGGGGTGGGGTTTGG - Intergenic
1080627796 11:34046375-34046397 GAAAGAAGGGGGGTGGGGCGCGG - Intergenic
1081616783 11:44596080-44596102 TCCAGGAGGGAGCTAGGGCCGGG - Intronic
1081800234 11:45853764-45853786 TCCAGAAGAGTGGTGAGGCTTGG + Intronic
1081807130 11:45896804-45896826 CCCGGAAGGGTGGGGGGGCCAGG - Intronic
1081809745 11:45908160-45908182 TACAGATCTGGGGTGGGGCCAGG - Intergenic
1081969218 11:47186480-47186502 GCCAGGAGAGGGGCGGGGCCGGG - Intergenic
1082077083 11:47982122-47982144 AGGAGAAGGGGGCTGGGGCCTGG + Intronic
1082824288 11:57566944-57566966 TCTAGGAGGGGGGGGGGGGCGGG - Intronic
1083175548 11:60947801-60947823 ACCAGAAGGGGCCTGGGGCCTGG - Intronic
1083418973 11:62542956-62542978 TACTGCAGGGGCGTGGGGCCAGG + Intronic
1083584833 11:63849156-63849178 TCCAGAAGGTTGAGGGGGCCAGG - Intronic
1083594111 11:63910890-63910912 TCCCAAAGGGGGTAGGGGCCCGG + Exonic
1083667713 11:64284791-64284813 TCCGGCGGGGGGGCGGGGCCGGG - Intronic
1083671103 11:64300330-64300352 TCCAGGAAGGGGGCGGGGCAGGG - Intergenic
1083816049 11:65133064-65133086 TCCAGAAGGTGCTGGGGGCCAGG + Exonic
1083827126 11:65210241-65210263 CCCAGGAGGGGGCTGGGGCTAGG - Intronic
1083927653 11:65818243-65818265 TCCGGGCGGGGGGTGGGGCAGGG + Intergenic
1084278307 11:68068220-68068242 TGCAGAAGGGGGAAGGGCCCGGG + Intronic
1085297116 11:75437521-75437543 GAAAGCAGGGGGGTGGGGCCAGG + Intronic
1087553528 11:99684090-99684112 ACCAGACGGGGGTTGGGGCATGG - Intronic
1089335208 11:117718223-117718245 TCGGGAAGGGGGGTGGGGGATGG - Intronic
1089496740 11:118911845-118911867 CCCATAAGGGGGGAGGGGCAGGG + Intronic
1089608028 11:119653078-119653100 TCCAGAATGGGGGTCATGCCTGG + Intronic
1089625818 11:119750161-119750183 CCCAGAAGTGGGGTGGTGGCAGG + Intergenic
1089792299 11:120953790-120953812 TCCAGAAGTGGGATGAGCCCTGG + Intronic
1090552494 11:127838287-127838309 TGCTGAGGAGGGGTGGGGCCAGG - Intergenic
1091004302 11:131938636-131938658 TGCAAAAGGTGGGTGGGGCAGGG + Intronic
1091590837 12:1842209-1842231 TGCAGAAGGGGGCGGGGCCCAGG + Intronic
1091591177 12:1843735-1843757 TCCAGAATGGGGGCTGGGGCTGG + Intronic
1092128991 12:6095445-6095467 TGCAGAAGGTGGGTGTGGACTGG - Exonic
1092405261 12:8217343-8217365 TCATGAAGGTGGGTGGGGGCTGG + Intergenic
1092751073 12:11719728-11719750 TCCAGCACGGGGGTGGGTCTGGG + Intronic
1093942550 12:25070274-25070296 TCCAGCTGGGGGTTGGGGACAGG - Intronic
1094543971 12:31386631-31386653 TCCCGAGGGGGGATGGGCCCTGG + Exonic
1095654270 12:44650588-44650610 TATAGAGAGGGGGTGGGGCCAGG - Intronic
1095730934 12:45506149-45506171 TCCTGGAGGGTGGTGTGGCCAGG + Intergenic
1096113417 12:49041640-49041662 TGCAGAAGGTGAGTGGGGCTGGG - Exonic
1096512008 12:52135788-52135810 TACAGAAGGAGGGTTGGGCATGG - Intergenic
1096814949 12:54196086-54196108 GCCAGAGGAGGGGTGGGCCCAGG - Intergenic
1097054978 12:56243770-56243792 TGAAGAAGGTGGGTGGGGTCTGG - Exonic
1098635844 12:72782159-72782181 GCCTGTTGGGGGGTGGGGCCTGG + Intergenic
1101580656 12:106038568-106038590 AGCAGAAGGGGGGTGGGCCGTGG + Intergenic
1101717197 12:107320983-107321005 TCCTTGAAGGGGGTGGGGCCGGG + Intronic
1102055696 12:109894926-109894948 TCCAGGCAGGGGGTGGGGTCGGG + Intergenic
1102228877 12:111248609-111248631 TCAAGGAGGGGGGTGAAGCCAGG + Intronic
1102605787 12:114066203-114066225 ACCACAAGGGGGGTGGGGGGAGG + Intergenic
1103609884 12:122116816-122116838 TGCAGAAGGTGGGCTGGGCCGGG + Intronic
1104707719 12:130959979-130960001 TCCAGATGTGGGGAGGGGCCCGG - Intronic
1105896018 13:24718082-24718104 TCCAAAAGGGGGGTGGAGGGAGG + Intergenic
1106032064 13:26012724-26012746 TGCTGACGGGGGGTGGGGGCGGG + Intronic
1106882959 13:34151807-34151829 CCTAGAAGGGTGGTGGGGCACGG - Intergenic
1107534268 13:41312118-41312140 TCCCAAAGGGAGGTGGTGCCAGG - Intronic
1107614868 13:42155723-42155745 TACAGAAGGTGGGTCGGGCGTGG - Exonic
1107835043 13:44406166-44406188 TCCAGAAGGAGGGTGAAGGCTGG - Intergenic
1108292638 13:48976362-48976384 TGCAGAGGGGCAGTGGGGCCGGG + Intronic
1110706830 13:78607364-78607386 TCCAGAAGGAGCGAGGGGCCCGG - Intergenic
1111237723 13:85431070-85431092 GCCAGAAGTGGGGTGGGAGCAGG - Intergenic
1113649826 13:112027421-112027443 CCCAGAAGTCGGGTGGGGACAGG + Intergenic
1113649840 13:112027458-112027480 CCCAGAAGTTGGGTGGGGGCAGG + Intergenic
1113660461 13:112103833-112103855 TGCAGGAGGGGGGCGGGGGCGGG + Intergenic
1113990670 14:16024989-16025011 TCCATATTGGGGCTGGGGCCAGG - Intergenic
1114201802 14:20528013-20528035 ACAAGAAGCGGGGTGGGGCGGGG + Intergenic
1114270632 14:21098232-21098254 TCCGGGAGGGGGGAGGGGGCCGG + Intronic
1115753560 14:36513633-36513655 GCCAGGAGGGGGGTGGGGGCAGG - Exonic
1117777995 14:59201620-59201642 TTTAGAAGGGGGGTGAGGCAGGG - Intronic
1119265138 14:73259923-73259945 TCCATAAGGCGGGAGTGGCCGGG - Intronic
1119415186 14:74465104-74465126 TCCAGATGGGTGGTGGGCCAGGG - Intergenic
1119700353 14:76750523-76750545 TCCGGAAGGGAGGTGGGGGGGGG + Intergenic
1119731993 14:76956861-76956883 TCCAGCAGGGGTGTGTGGCGTGG + Intergenic
1120817679 14:88880683-88880705 ACCAGAAGAGGGGTGGGGTTTGG - Intronic
1121052922 14:90831120-90831142 TCCAGAAGGCGGGCAGGGGCTGG + Intergenic
1121631171 14:95422860-95422882 CCCAGGAAGGGGGTGTGGCCAGG + Intronic
1121997249 14:98612798-98612820 TGAAGAAGTGAGGTGGGGCCAGG + Intergenic
1122269500 14:100562221-100562243 TCCTGAAGGTGGGTGCCGCCAGG + Intronic
1122873312 14:104651209-104651231 TCCAGAAGGAGGGCGTGGACGGG + Intergenic
1123114914 14:105890276-105890298 TGCAGATGGGGGGTGGGGGGTGG + Intergenic
1124138221 15:27053964-27053986 TTCAAAAGGAGGGAGGGGCCGGG + Intronic
1124369986 15:29099059-29099081 TCCAGGAGGGGGCTGGTTCCAGG - Intronic
1124493785 15:30174174-30174196 TGCAGAGGGAGGGTGGGGGCTGG - Intergenic
1124749783 15:32364475-32364497 TGCAGAGGGAGGGTGGGGGCTGG + Intergenic
1125520083 15:40343597-40343619 TGGAGATGGGGTGTGGGGCCAGG - Intergenic
1126674436 15:51147145-51147167 ACAAGAAGGGAGGTGTGGCCAGG - Intergenic
1126761994 15:51977830-51977852 TCCAAATGGTGGCTGGGGCCAGG - Intronic
1128345538 15:66850393-66850415 TTCAGAAGGGGGATGGGGCATGG + Intergenic
1128712381 15:69881814-69881836 TGTGGAAGGGGGATGGGGCCAGG + Intergenic
1129221872 15:74135907-74135929 GCCAGAAGTGGGGTGGGGGTGGG - Exonic
1129255865 15:74333723-74333745 TCCAGAAGAGGGTTCGGCCCAGG + Intronic
1129503930 15:76065304-76065326 TTCAGTAGAGGGGTGGGGGCAGG - Intronic
1129600530 15:76995757-76995779 TCCAGAAGGGGTGGGGGCCTGGG - Intronic
1129740779 15:77988625-77988647 TCCTGGAGGGAGGTGAGGCCTGG + Intronic
1129844945 15:78763915-78763937 TCCTGGAGGGAGGTGAGGCCTGG - Exonic
1129848057 15:78777077-78777099 TCCAGAGGAGGGGCTGGGCCGGG - Intronic
1130070654 15:80644258-80644280 ACCAGCAGTGGGGTTGGGCCAGG + Intergenic
1130256881 15:82329925-82329947 TCCTGGAGGGAGGTGAGGCCTGG + Intergenic
1130598067 15:85260063-85260085 TCCTGGAGGGAGGTGAGGCCTGG - Intergenic
1131630907 15:94175995-94176017 TTAAGATGGGGGGTGTGGCCGGG + Intergenic
1132043806 15:98547828-98547850 TCTGGAGGCGGGGTGGGGCCGGG + Intergenic
1132527620 16:425586-425608 GCCCGACGGGGGGCGGGGCCTGG + Intergenic
1132578699 16:675512-675534 GCCAGAGCGGGGGTGGGGGCCGG + Intronic
1132659995 16:1057069-1057091 TACAGGATGGGGGTGGGGCGAGG + Intergenic
1132742758 16:1423628-1423650 TAAAGAATGGGAGTGGGGCCGGG - Intergenic
1132890853 16:2203882-2203904 TCAAGAAGTGGGAGGGGGCCGGG + Intergenic
1133001822 16:2855758-2855780 CCCAGAAGGTGGGTGTTGCCTGG - Exonic
1133028172 16:2997613-2997635 TACAGAAGGGGGCTGGAGCCTGG - Intergenic
1133033356 16:3021929-3021951 ACCACAAGGGGGGTGGGGGGCGG + Exonic
1134066432 16:11231520-11231542 GCAAGCAGGGGGATGGGGCCAGG + Intergenic
1136054850 16:27680693-27680715 TGCAGAGGGAGGGTGGGGCGGGG + Intronic
1136101281 16:27998150-27998172 CTCAGAAGTGGGGAGGGGCCAGG - Intronic
1136282142 16:29220243-29220265 TCCACAAGGGGGGTGTGGGTGGG + Intergenic
1136588337 16:31202105-31202127 TGCAGGAGTGCGGTGGGGCCGGG + Intronic
1136774195 16:32862920-32862942 TCCAGCAGGGGGCTGCGTCCTGG - Intergenic
1136777892 16:32881386-32881408 TCCAGAAGAGGAGGGGGGCCCGG - Intergenic
1136892730 16:33980128-33980150 TCCAGAAGAGGAGGGGGGCCCGG + Intergenic
1136896416 16:33998594-33998616 TCCAGCAGGGGGCTGCGTCCTGG + Intergenic
1137551174 16:49438611-49438633 CCCAGCAGGGTGGTGGGGCAAGG + Intergenic
1137564765 16:49526049-49526071 TCTAGGAGAGGGGTGGGGGCAGG + Intronic
1137727534 16:50667252-50667274 CCCAGAAAGGGGGTAGGTCCAGG - Intronic
1137787729 16:51151809-51151831 CCCGGGTGGGGGGTGGGGCCGGG + Intergenic
1138529571 16:57627844-57627866 ACCAGAAGGGGGATGGGGCATGG + Intronic
1139486118 16:67257509-67257531 TCTAGAAGGGGGGTGGGTAGGGG - Exonic
1139531337 16:67544132-67544154 TCCAGAAGGAGGAAGGGGCTGGG - Intronic
1139598326 16:67970656-67970678 TCCAGATGAGGGGTGGGGTGGGG - Intergenic
1139692990 16:68653144-68653166 TCCGGAAAGGGGGTGGGGTCTGG - Intronic
1140078377 16:71723113-71723135 TGCGGAAGGGAGGAGGGGCCGGG - Intronic
1140631152 16:76854119-76854141 TCAAGAAGGGATGTGTGGCCAGG + Intergenic
1141007578 16:80366939-80366961 TCCAGAAGTGTGGTGGCTCCAGG + Intergenic
1141184943 16:81780083-81780105 TCCAGCAGGACGGTGGGGCGGGG + Intronic
1141614360 16:85202233-85202255 TCCAGAAGGCAGTTGGGGCTGGG - Intergenic
1141659859 16:85435951-85435973 CCCAGAAGGCAGGTGGGGTCTGG + Intergenic
1142003055 16:87675144-87675166 GCCAGCTGGGGGGTGGGGCATGG - Intronic
1142109296 16:88322763-88322785 TCCTGAAGGTGGGTGGGCACGGG - Intergenic
1142399138 16:89850251-89850273 TACTGCAGGGGGGTGGGGCGGGG - Intronic
1203076619 16_KI270728v1_random:1125039-1125061 TCCAGCAGGGGGCTGCGTCCTGG - Intergenic
1203080310 16_KI270728v1_random:1143495-1143517 TCCAGAAGAGGAGGGGGGCCCGG - Intergenic
1142636408 17:1260322-1260344 TCCAGGAGTGGGGCGGGGGCGGG - Intergenic
1142913109 17:3112517-3112539 TCCAGGAGGGAGGTGGGGGGGGG - Intergenic
1143706203 17:8699139-8699161 TCCAGGAGGGAGATAGGGCCTGG + Intergenic
1144004759 17:11089855-11089877 TCCAGAAGGGGAGGCGGGCAAGG - Intergenic
1144632873 17:16882842-16882864 TCCTGATGGGGGGTCTGGCCTGG - Intergenic
1145395259 17:22489305-22489327 GGCAGCAGGGTGGTGGGGCCTGG - Intergenic
1146302981 17:31705851-31705873 TCCAGCCTGGGGGTGGGGCTGGG - Intergenic
1146936765 17:36816846-36816868 TCCAGCAGCGGGGCGGGGCGGGG - Intergenic
1147184693 17:38706679-38706701 TCCAGAAAGGGCGTGGGGGGAGG + Intronic
1147222755 17:38948503-38948525 TCCAGAATAGGGGCGGGGCGTGG - Intronic
1147235118 17:39051414-39051436 TCCAGAAGGCTGGGGTGGCCCGG + Intergenic
1148356850 17:46980998-46981020 TAGCGAAGGGGGGTGGGGGCAGG + Intronic
1148456973 17:47816377-47816399 TCAAGAATGGGGGTGAGGCCTGG - Exonic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148562849 17:48616095-48616117 TCCAGAGAAGGGGTGGGGGCAGG - Intronic
1148582943 17:48756056-48756078 TCCAGAGTGGGGGTGGGGCTGGG - Intergenic
1150289652 17:63973921-63973943 GGCAGAAGGGGAGAGGGGCCAGG - Intergenic
1150292261 17:63988606-63988628 ACCAGAAGGGGTCTGGGGGCGGG - Intergenic
1150497907 17:65623227-65623249 TGGTGAAGGTGGGTGGGGCCTGG + Intronic
1150952641 17:69821042-69821064 TGCAGCAGGGAGGTGCGGCCTGG + Intergenic
1151309274 17:73283565-73283587 TTCAGGATGGGGGTGGGGTCTGG - Intergenic
1151313973 17:73310967-73310989 TCCGGAGAGGGGGCGGGGCCAGG + Intronic
1151496212 17:74459771-74459793 TCCAGGAGAGGGGAGGGGCTAGG - Intergenic
1151718904 17:75844774-75844796 TCCAGACGTGGGGCGGGGCGGGG + Intergenic
1151766856 17:76137326-76137348 TCCAGAGGTGGGGCAGGGCCTGG + Exonic
1152107402 17:78338748-78338770 TCCAGTTGGGGGGGGGAGCCTGG - Intergenic
1152325254 17:79632286-79632308 TACAGATGAGGGGTGGGGCCGGG + Intergenic
1152356328 17:79809479-79809501 GCCAGAGGGGCGGTGGGTCCTGG - Intergenic
1152527232 17:80895315-80895337 TCCAGGTGGGGCGTGGGGCTGGG - Intronic
1152539260 17:80966783-80966805 TCCAGAAGTGGGGAGGAGCGGGG - Intergenic
1152582478 17:81172480-81172502 TCAAGAAGGTTGCTGGGGCCAGG + Intergenic
1152612415 17:81322368-81322390 TCCAGAAGGCGGGTGGGCACCGG - Intronic
1152622530 17:81372473-81372495 TTCAGGAGGGAGGAGGGGCCGGG - Intergenic
1152664034 17:81557035-81557057 TCCCGAGAGGAGGTGGGGCCTGG - Exonic
1152718326 17:81910534-81910556 TCTGGAATGGGGCTGGGGCCTGG + Intronic
1152792664 17:82290317-82290339 TGGAGCAGGGGTGTGGGGCCAGG + Intergenic
1152856469 17:82667525-82667547 TCCAGGAAGGGGGCAGGGCCCGG - Intronic
1153605472 18:6827643-6827665 TCCAGGAGGGAGGTGGGGGGGGG - Intronic
1154176844 18:12091638-12091660 CCGGGAAGGGGGCTGGGGCCAGG + Intergenic
1154991427 18:21601207-21601229 TAAAGAAGGAGGGTGGGGCCGGG + Intergenic
1155314927 18:24562129-24562151 ACCAGAAAGGGAGTGTGGCCCGG + Intergenic
1156499046 18:37545359-37545381 GCCAGAGGTGGGCTGGGGCCAGG + Intronic
1157696957 18:49730655-49730677 CCCAGAAGGGGAGTAGGGCTAGG - Intergenic
1157736150 18:50051492-50051514 TCAAAAAGGGAGGTGGGGCCAGG + Intronic
1157745737 18:50133752-50133774 TCCTGGAGGTGGGAGGGGCCTGG - Intronic
1160510038 18:79448280-79448302 TCAGGAAGGGTGCTGGGGCCTGG + Intronic
1160515253 18:79476010-79476032 TCCAGAAGGGGGGTGGGGCCGGG + Intronic
1160761718 19:788864-788886 TGCAGAGTGGGGGTGGGGCGGGG - Intergenic
1160770335 19:828226-828248 TCCAAAAGGGGGCTGGAGCCTGG - Exonic
1160788251 19:911918-911940 CCCAGAGGGCGAGTGGGGCCGGG + Intronic
1160847823 19:1174102-1174124 CCCACAAGCGGGGTCGGGCCAGG + Intronic
1160943375 19:1630247-1630269 CCCGGCAGGGGGGCGGGGCCAGG + Intronic
1161028259 19:2046517-2046539 CCCTGCAGGGGGGTGGGGGCCGG - Intronic
1161062816 19:2223499-2223521 GCCCGGAGGGGGGCGGGGCCTGG + Intronic
1161084205 19:2326763-2326785 TTCAGAAAGGGTTTGGGGCCGGG - Intronic
1161184451 19:2907031-2907053 TCCAGGCGGGGGGTGGGGGCGGG + Intronic
1161364148 19:3868678-3868700 TCCTGAAGTGGGAGGGGGCCTGG - Intronic
1161793331 19:6373449-6373471 TCGAGCGTGGGGGTGGGGCCAGG + Intronic
1161820697 19:6529166-6529188 TCCAGTGGGTGGGTGGGGGCAGG + Intergenic
1162405285 19:10469432-10469454 TGGAGAAGGGGGGAGGGGACAGG - Exonic
1162455837 19:10784296-10784318 TCCAGTAGGGGCGCGGGGGCCGG + Intronic
1162480456 19:10924181-10924203 TCCAGAAGGGGCCTGGGGGTAGG + Exonic
1162810717 19:13163143-13163165 TCCGGAAAGGGGGCGTGGCCCGG - Intergenic
1163612915 19:18310294-18310316 TCCAGAAGTGAGGTGGGGCTGGG - Intronic
1163717435 19:18880194-18880216 TCCAGAAAAGGGGCGGGACCAGG - Intronic
1163732289 19:18956019-18956041 TTGAGAAGGTGGATGGGGCCAGG + Intergenic
1164944548 19:32282488-32282510 TCAAGAGGTGGGGTGGGGCAGGG - Intergenic
1165177863 19:33943245-33943267 TGCAGAGAGGGAGTGGGGCCTGG - Intergenic
1165231989 19:34393120-34393142 TCCTGGAGGTGGGTTGGGCCAGG + Intronic
1165333615 19:35154723-35154745 TCCAGGCGGAGGGTGTGGCCAGG - Intronic
1165382615 19:35491906-35491928 TCCAAACTGGGGGTGGGGCAAGG - Intronic
1165471548 19:36007327-36007349 TACAGAAGAGGGGTGGGGATGGG - Intronic
1166084509 19:40466039-40466061 TCCCGGAGAGGGGCGGGGCCAGG + Intergenic
1166100612 19:40569534-40569556 TGCAGAAGTGGGCAGGGGCCTGG + Intronic
1166293861 19:41879458-41879480 TGCAGGAGGTGGGCGGGGCCAGG + Intronic
1166699535 19:44874309-44874331 TCCTGGAGGGGTGTGGGGTCAGG - Exonic
1166985807 19:46659595-46659617 TCCTGAGAGGGGGAGGGGCCGGG + Intronic
1167119483 19:47508013-47508035 TCTAGAGGAGGGGTGGGGGCAGG - Intronic
1167166164 19:47802008-47802030 GCCATAAGGGGGCTGGGGCTGGG + Exonic
1167263315 19:48470739-48470761 TCCAGAAGCGTGATGGTGCCGGG + Intronic
1167279498 19:48558579-48558601 TCCCTAAGGAAGGTGGGGCCGGG - Intronic
1167337668 19:48896605-48896627 GACAGAAGTGAGGTGGGGCCTGG + Intronic
1167375266 19:49107796-49107818 TGCGGAAGCGGGGAGGGGCCGGG - Exonic
1167510616 19:49893691-49893713 TAAAGAAGGGAGTTGGGGCCGGG + Intronic
1168056850 19:53869034-53869056 TCCTGGAGGGGCGTGGGGGCAGG + Intronic
1168287557 19:55342150-55342172 TCCAAGTGGGGGTTGGGGCCGGG + Intronic
1168295931 19:55377338-55377360 TGAAGGAGGGGGCTGGGGCCTGG + Intronic
1168295957 19:55377407-55377429 TGAAGGAGGGGGCTGGGGCCTGG + Intronic
1168649688 19:58085362-58085384 TCCAGAAGGCGGGAGGCGGCAGG - Exonic
1168695955 19:58404869-58404891 TCCAGGAGGGAGGTGGGGGGGGG - Intronic
925288313 2:2730178-2730200 GCCAGGAGGGATGTGGGGCCTGG + Intergenic
926690911 2:15732738-15732760 TCTAGAGATGGGGTGGGGCCGGG + Intronic
926764866 2:16315281-16315303 TCCATAAGTGGGATTGGGCCTGG + Intergenic
927304365 2:21553743-21553765 TCTAGAAGTGAGGTGGGGCTGGG + Intergenic
927865028 2:26582774-26582796 TCCAGGAGAGTGGTGGGGGCAGG - Intronic
929054459 2:37863754-37863776 TCCAGAAAGAGGGTGGGGTTGGG - Intergenic
932455667 2:71848259-71848281 GAGAGAAGGGGGGTGGGGGCGGG + Intergenic
932586430 2:73032646-73032668 GCCAGATTGGGGGTGGGGCTGGG - Intronic
932891059 2:75597880-75597902 TCCAGAATCGGGGTGGGGTGGGG + Intergenic
934605318 2:95690757-95690779 GCCAGTAGGTGGGTGAGGCCAGG + Intergenic
934696684 2:96405164-96405186 TACAGAGGGGAGGTGTGGCCAGG - Intergenic
935273920 2:101459949-101459971 GCCAGGTGGGGGGTGGGGCGGGG - Intronic
935673564 2:105575674-105575696 TTCAGAGGGAGGGTGGGTCCAGG + Intergenic
936538775 2:113333310-113333332 GCCAGTAGGTGGGTGAGGCCAGG + Intergenic
936913802 2:117618786-117618808 TCCAGAAGGGGGCAGGCTCCAGG - Intergenic
938082207 2:128376275-128376297 TCCAGAAGGTGGGAGGGAGCTGG + Intergenic
938082759 2:128378949-128378971 TCCAGGGGAGGGGTGGGGCTGGG + Intergenic
938230305 2:129653350-129653372 CCCAGATGGAGGGTGGGGGCAGG + Intergenic
940761266 2:157741860-157741882 TCCAGGAGGGAAGTGGGGCATGG + Intronic
941385608 2:164847434-164847456 TCCAGAATAGAGGTGAGGCCTGG + Intergenic
943363413 2:186947185-186947207 TGCAGAAGGCTGCTGGGGCCAGG + Intergenic
946328692 2:218997835-218997857 TCCAGACTGGGGGTGGGGGCGGG - Intergenic
946393928 2:219434102-219434124 GGAAGAAGGGAGGTGGGGCCTGG - Intergenic
947151615 2:227122156-227122178 CCCAGAAGGGAGATGGGGCAGGG - Intronic
947636356 2:231682511-231682533 CCCAGAAGAGAGGTGGGGCCAGG - Intergenic
947650315 2:231781035-231781057 TCCGGGAGCGGGGCGGGGCCGGG - Intronic
947877224 2:233475650-233475672 TCCAGCAGGCGCGTGCGGCCGGG - Exonic
948616337 2:239201649-239201671 TTGAGAAGGGAGGTGGGGCCTGG - Intronic
1168851161 20:978034-978056 TCTAGCAAGGGGGTGGGCCCTGG + Intronic
1169276530 20:4236852-4236874 TCTAGAAGGTGGAAGGGGCCGGG + Intronic
1170057682 20:12224655-12224677 TGCACAATGGGGGTGGGGCATGG - Intergenic
1171411298 20:24950329-24950351 GACAGAAGGGGGCTGGAGCCTGG + Intronic
1171414630 20:24969298-24969320 GCCAGCAGGGGAATGGGGCCCGG + Intronic
1172449297 20:35010486-35010508 TCGGGGATGGGGGTGGGGCCAGG - Intronic
1173317703 20:41959897-41959919 ACCAAAAGTGGAGTGGGGCCAGG - Intergenic
1173462950 20:43258656-43258678 TCCCCAATGGAGGTGGGGCCTGG + Intergenic
1173826639 20:46051892-46051914 GACAGAAGAGGGGTGGGGCTGGG + Intronic
1174553436 20:51377744-51377766 CCCAGAAGCTGGGAGGGGCCAGG + Intergenic
1175026792 20:55910885-55910907 GCCTGTAGGGGGGTGGGGGCTGG + Intergenic
1175893621 20:62326539-62326561 AGCAGAAGCGGGGTGGGGGCTGG - Intronic
1175961803 20:62641252-62641274 TCCAGAAGTGGAGGGCGGCCTGG + Exonic
1176008537 20:62879873-62879895 TCCAGCAGGGGCCTGGGGCCCGG + Exonic
1176054260 20:63135509-63135531 CCCAGAGGGGAGGCGGGGCCCGG + Intergenic
1176097320 20:63350070-63350092 TCCAGGCGAGGGGTGGGGGCTGG + Exonic
1176168261 20:63685688-63685710 TCCAGGAGGCAGGTGGGGCTGGG + Intronic
1176390144 21:6159054-6159076 TCCAGGAGGGGAGTCGGGGCAGG - Intergenic
1177169205 21:17637420-17637442 TCAAGAAGTGGGGTCTGGCCGGG - Intergenic
1177790958 21:25721635-25721657 TCAAGAAGAGGGGGAGGGCCAGG + Intronic
1178075546 21:29011523-29011545 TCCGGAAGGGAGGTGGGGGGGGG + Intronic
1178616957 21:34143151-34143173 TCCAGAGCCGGGGTGGGGCAGGG + Intergenic
1179006315 21:37518487-37518509 TTCAGAGTTGGGGTGGGGCCTGG + Intergenic
1179571138 21:42279542-42279564 CCCAAAAGGCAGGTGGGGCCTGG - Intronic
1179707259 21:43188834-43188856 TTAAGAAGGGTGGTGGGGGCGGG - Intergenic
1179733322 21:43379186-43379208 TCCAGGAGGGGAGTCGGGGCAGG + Intergenic
1179828692 21:43982757-43982779 TGCAGAAGAGGTGAGGGGCCAGG - Exonic
1179873754 21:44257032-44257054 TACAGAAGGGGTGTGGCCCCCGG - Intronic
1180082397 21:45492952-45492974 TCCAGAGTGAGGCTGGGGCCGGG + Intronic
1180137260 21:45869702-45869724 GACAGAAGGGCAGTGGGGCCTGG + Intronic
1180153960 21:45968647-45968669 TCCAGGAGGTGGGTGGGGCAGGG + Intergenic
1180211209 21:46296297-46296319 TCAAGATGGAGGGTGGGGGCTGG - Intronic
1180316600 22:11282537-11282559 TCCATATTGGGGCTGGGGCCAGG + Intergenic
1180952809 22:19728372-19728394 GGCAGAAGGGGTCTGGGGCCAGG - Intergenic
1181001855 22:19991556-19991578 TCCAGAAAAGGGCAGGGGCCAGG + Intronic
1181403757 22:22667497-22667519 TCCAGAGGGTGGGTGGTCCCTGG - Intergenic
1181849826 22:25742107-25742129 CCCAGAAGGAGGGTGGGGGGAGG + Intergenic
1181874980 22:25933338-25933360 GCCAGGTGGAGGGTGGGGCCAGG - Intronic
1181964368 22:26646262-26646284 TCCAGAAGGCAGGTAGGGACTGG - Intergenic
1182119090 22:27775323-27775345 TCCAGAGGGTGGGAGTGGCCAGG + Intronic
1182771744 22:32801567-32801589 TCCAAAAAGGGGGCGGGGCCGGG - Intronic
1182874624 22:33680314-33680336 TCCAGAATGGGGCTCGGGGCGGG + Intronic
1183170376 22:36183396-36183418 TCTAGAATGGGGGAGGGGCTAGG + Intergenic
1183189775 22:36314383-36314405 TTGAGAAGGAGGGTGGGGCAGGG + Intronic
1184297279 22:43532822-43532844 GCCAGGTGGGGGGTGGGGCCAGG + Intronic
1184813992 22:46856628-46856650 TCAAGAGTGGGGGTGGGGGCTGG + Intronic
1185080303 22:48706032-48706054 TGCAGACGGGAGGTGGGGGCTGG + Intronic
949573428 3:5315281-5315303 CCCAGAAGAGGAGTTGGGCCAGG - Intergenic
950074442 3:10177404-10177426 TTCAGAGTGGAGGTGGGGCCAGG - Intronic
950354268 3:12391365-12391387 TCCAGAAGAGAGGTGGGGCAGGG + Intronic
951247677 3:20359939-20359961 TCAAGAAGTGGGGGAGGGCCAGG - Intergenic
953134013 3:40167232-40167254 TGCAGAAGGTAGGTGGGTCCTGG + Exonic
953537880 3:43789789-43789811 TCAAGAAGAGCGGTGAGGCCAGG - Intergenic
954080676 3:48211423-48211445 TCCAGGAGGGAGGTGGGGGGGGG + Intergenic
954224163 3:49171969-49171991 TCCAGAAGTGGGGTTGGGGCGGG - Intronic
954361334 3:50124322-50124344 TGCAGGGTGGGGGTGGGGCCGGG - Intergenic
954674689 3:52309247-52309269 TCCAGCACTGGGCTGGGGCCAGG + Intergenic
955112034 3:55959090-55959112 TCTAGAAGAGGGTTGGGGCAGGG - Intronic
955960853 3:64340071-64340093 TACAGAAGTGGGGCTGGGCCAGG - Intronic
956685223 3:71820581-71820603 TCCAAAAGGGGGGAGGGAGCAGG + Intergenic
957624342 3:82640408-82640430 TGCAGCAGGGAGGTGTGGCCCGG + Intergenic
959476687 3:106821063-106821085 TCCAGGAGTGGGGAGAGGCCAGG - Intergenic
960266124 3:115623266-115623288 TCTAGAATGGGGGTAGGGGCTGG + Intergenic
960490137 3:118307559-118307581 TCCCCAATGGAGGTGGGGCCTGG + Intergenic
961202596 3:125056194-125056216 GCAGGAAGGGGGCTGGGGCCGGG + Intergenic
961649673 3:128411090-128411112 TCCATTAGTGGGGTCGGGCCAGG + Intergenic
962391885 3:134978973-134978995 TCCTCATGGAGGGTGGGGCCAGG + Intronic
963906185 3:150775031-150775053 ACCAGGAGGGGGGAGAGGCCAGG + Intergenic
964837052 3:160950574-160950596 TCCAGGAGGCAGGTGTGGCCAGG - Intronic
964927348 3:161975294-161975316 GCCAGAAGCGGGGAGAGGCCAGG + Intergenic
965051469 3:163655117-163655139 ACCAGAAGCGGGGAGAGGCCAGG + Intergenic
967931831 3:194695570-194695592 TCCAGGATGGGGGTGAGTCCTGG - Intergenic
968522875 4:1042117-1042139 GCCAGCAGGGGAGTGTGGCCTGG - Intergenic
968566808 4:1317409-1317431 GCCAGCAAGAGGGTGGGGCCAGG - Intronic
968798084 4:2722480-2722502 TCCAGAAGGGGCTGGGGGACAGG + Intronic
968812009 4:2804412-2804434 CCCAAAAGGGGGCTGTGGCCTGG + Intronic
969237553 4:5876736-5876758 TTCAGAAGGGGGGTGGTGGGGGG - Intronic
969760853 4:9180628-9180650 TCATGAAGGTGGGTGGGGGCTGG - Intergenic
970565289 4:17326131-17326153 TCCTGTAGTGGGGTGGGGCGGGG - Intergenic
971292329 4:25355430-25355452 TCCACCATGGGGGTGGGGTCAGG + Intronic
971406214 4:26322099-26322121 ACCAGGAGGGGGGCGGGGGCCGG - Intronic
972313121 4:37899823-37899845 TCAAGAAGGAAGGTGTGGCCGGG + Intronic
973264302 4:48195989-48196011 ACCAGAAGGGAGGTGAGGCGGGG - Intronic
975697132 4:77024435-77024457 GCCAGAAAGGGGCTGGGGTCTGG - Intronic
977644867 4:99401390-99401412 TCCAGCAAGGGGATGGGGCAGGG + Intergenic
978371790 4:108036504-108036526 TCAAGAGGGAGGGTGGGTCCTGG + Intergenic
978621013 4:110634180-110634202 TCCTGAAGGGAGCTGGGCCCTGG + Intronic
980994937 4:139771040-139771062 TCCAGAAGGAGGGTGTGGTGTGG - Intronic
981110323 4:140927358-140927380 TCCAGTTTGGAGGTGGGGCCTGG + Intronic
981619709 4:146680461-146680483 GCCTGTTGGGGGGTGGGGCCTGG + Intergenic
982107692 4:152024960-152024982 TCCAGAAGTTGTGGGGGGCCTGG + Intergenic
984828190 4:183947073-183947095 TCCTGGTGGGGGGTGGGGCAAGG + Intronic
985365707 4:189229852-189229874 TCGGGAAGGGTGGTGGGGCGGGG + Intergenic
985551053 5:533819-533841 GCCAGGAGGGGGCTTGGGCCTGG - Intergenic
985622725 5:963926-963948 TCCTGTGGGGAGGTGGGGCCAGG - Intergenic
985774080 5:1831634-1831656 CCCAGAGGGGGCCTGGGGCCTGG + Intergenic
986646080 5:9917311-9917333 TCTGGAAGAGGGGTGGGGCGGGG - Intergenic
989021362 5:37013045-37013067 TCCAGGAGGGAGGTGGGGGGGGG - Intronic
990149464 5:52800289-52800311 GCCAGGAAGGGGGCGGGGCCCGG - Exonic
991371909 5:65926993-65927015 TCCAGATGGTGGGGGGGGCAGGG - Intronic
991533390 5:67639427-67639449 ACAAGGAGGGGGGTGGGGCGGGG - Intergenic
992080431 5:73231009-73231031 TTGAGAAGGGGGCTGGGGCGGGG - Intergenic
992801838 5:80301552-80301574 TCCGGGAGGGAGGTGGGGCCGGG + Intergenic
992964018 5:81983238-81983260 TCCAGGAGGGAGGTGGGGGGGGG - Intronic
993050258 5:82918393-82918415 TCAAGAAGCGGGGTGGGGCAGGG - Intergenic
995264384 5:110140330-110140352 GCCAGTCGGGGGGTGGGGGCTGG + Intergenic
995286002 5:110388801-110388823 TGCAGAATCGGGGTGGGGGCAGG + Intronic
996397372 5:123026828-123026850 TACAGAAGGGGAGGTGGGCCTGG - Intronic
996646710 5:125826388-125826410 TCCAGAAGGAGAATGGGGACAGG - Intergenic
996930008 5:128874959-128874981 TCCATGTTGGGGGTGGGGCCTGG + Intronic
997362128 5:133301787-133301809 TCTAGATGGGGAGTGGGGCACGG + Intronic
997477288 5:134151247-134151269 TCAGGAAGCGGGGTGGGGCTTGG + Exonic
998011951 5:138702513-138702535 CCCAGAGGTGGGGTGGGTCCTGG - Intronic
998192877 5:140042298-140042320 TGGAGAATGGGGGTGGGGCGGGG - Intronic
999325605 5:150641540-150641562 CACAGGAGGGAGGTGGGGCCGGG - Intronic
1000660120 5:163927974-163927996 TCCATGTTGGGGGTGGGGCCTGG - Intergenic
1000834357 5:166135603-166135625 TCGGGAAGGGGGGTATGGCCAGG + Intergenic
1001335050 5:170789959-170789981 TGAAGAAAGGGGATGGGGCCTGG - Intronic
1001653238 5:173329723-173329745 TCCAGGAGGAGGGTGGGGACGGG - Intergenic
1002159066 5:177304227-177304249 TCCTGAAGGGAGGTTGGGCCTGG + Intronic
1002295170 5:178226565-178226587 TCTAGAAGGGTGGTGCGCCCAGG - Intronic
1002312098 5:178320915-178320937 TCCAGAGGTGGGGTGTGGGCAGG + Intronic
1002458138 5:179357684-179357706 TCCAGCAGGGCAGTGGGACCAGG + Intergenic
1002530401 5:179841108-179841130 TGAAGCAGGGGAGTGGGGCCTGG - Intronic
1002626457 5:180532936-180532958 TCCTGAAGGGTGGTGTGCCCAGG - Intronic
1002815942 6:680445-680467 TGGAGAAGGGTGGAGGGGCCAGG + Intronic
1003931204 6:10926151-10926173 TCCTGTAGGGAGGTGGGGCCTGG + Intronic
1004492092 6:16127197-16127219 TCGTGAAGGGGGGTAGGGACAGG + Intergenic
1005620731 6:27617778-27617800 TCCACAAGGGGAAAGGGGCCGGG - Intergenic
1006095172 6:31651901-31651923 ATCAGAAGGGGGATGGGGACAGG - Intronic
1006098500 6:31671053-31671075 TCCAGGAAGGGGGTGGAGCGTGG + Intronic
1006449669 6:34098861-34098883 TGCAGAGAGGGGGTGGGGGCTGG + Intronic
1006601435 6:35229111-35229133 TCTAAAATGGGGGTGGGACCAGG + Intronic
1006975606 6:38098060-38098082 TCAAAAAGCGGGGTGGGGCCAGG - Intronic
1007288476 6:40765689-40765711 TCCAGAAGGAGGTCGGGGACAGG - Intergenic
1007416594 6:41694715-41694737 GCCAGATGGTGGGAGGGGCCAGG - Intronic
1008043151 6:46823238-46823260 TGCAGAAGTGTGGTGTGGCCAGG - Intronic
1008494908 6:52123319-52123341 ATCAGAAGGGGGTTGGGGGCAGG + Intergenic
1010154018 6:72770992-72771014 TCTAGAAGGGGGAAGGGGGCGGG + Intronic
1010982283 6:82381900-82381922 TCCAGAAGGAGGATGGGGGTGGG - Intergenic
1012945571 6:105461970-105461992 TTAAGAAGGTGGGTGGGGGCAGG - Intergenic
1013227887 6:108133868-108133890 TCCAGCCGTGCGGTGGGGCCCGG - Intronic
1013560955 6:111304755-111304777 TCCAAAAGGGGGGTGAGGAGAGG - Intronic
1013756766 6:113471253-113471275 ACCAGAAGGGGGGTTGTGCATGG - Intergenic
1014888242 6:126808831-126808853 TCCTGGAGGGGGGTGGGGGGTGG - Intergenic
1017054324 6:150424197-150424219 TGCAGCAGGGAGGTGCGGCCAGG + Intergenic
1018461344 6:164002230-164002252 TCCTGAAGGAGGGTAGGGCGTGG + Intergenic
1018836119 6:167485440-167485462 TCCAGCATGGGAGTGGAGCCAGG + Intergenic
1019019295 6:168904095-168904117 ACGAGAAGTGGGGTGGGGGCAGG + Intergenic
1019523969 7:1472518-1472540 TCCACAAATGGGGTGGAGCCAGG + Intronic
1019630112 7:2044571-2044593 ACCAGCACGGGGGTGCGGCCGGG + Intronic
1019705255 7:2494428-2494450 GCCAGGAGGTGGGTGGGGCAGGG + Intergenic
1019786554 7:2980862-2980884 GCCAGGAGGGCGGTGGGGCAGGG + Intronic
1020044617 7:5031775-5031797 TGGAGGAGGTGGGTGGGGCCTGG - Intronic
1020289978 7:6715797-6715819 TCGAGGAGGTGGGTGGGGCCTGG - Intergenic
1020360220 7:7319891-7319913 TTAAGAAGGAGGGAGGGGCCAGG + Intergenic
1020761187 7:12269686-12269708 TCCAGAAGGGGCCTGGCGGCAGG - Intergenic
1021872496 7:25018992-25019014 TCCAGGAGGGAGGTGGGGGGGGG + Intergenic
1022671199 7:32457859-32457881 TGCAGAGGTGGGTTGGGGCCTGG + Intergenic
1024311565 7:47974369-47974391 TCCAGAGGGGTGGTGGGGAAAGG + Intronic
1024943756 7:54788392-54788414 TCCAGATGTGGGGTGGGGGGAGG - Intergenic
1026775190 7:73226789-73226811 TCCAGAAGGAGGAAGAGGCCGGG + Intergenic
1026837945 7:73650516-73650538 TCCAAATGGGGTGTGGGGCTGGG - Intergenic
1027016047 7:74780160-74780182 TCCAGAAGGAGGAAGAGGCCGGG + Intronic
1027071982 7:75165777-75165799 TCCAGAAGGAGGAAGAGGCCGGG - Intergenic
1028029914 7:85897795-85897817 TCCAGAAGCTGGGTGGTACCTGG - Intergenic
1028235851 7:88360938-88360960 TCCAGAAAGGAGATGGGGGCTGG + Intergenic
1029302778 7:99598276-99598298 TCCAGGAGCGCGGTGGAGCCTGG + Intronic
1029363567 7:100103339-100103361 TAAAGAGGGGGAGTGGGGCCAGG - Intronic
1029397745 7:100319801-100319823 TGGAGGAGGTGGGTGGGGCCTGG + Exonic
1029551390 7:101238911-101238933 CCCAGCAGGGCCGTGGGGCCAGG - Intergenic
1030075100 7:105730030-105730052 TTAAGAAGTGGGGAGGGGCCGGG - Intronic
1030817085 7:114051517-114051539 CCAAGAAGGTGGGTGGGGGCGGG + Intronic
1031155024 7:118100158-118100180 TACAAAAGGTGGGAGGGGCCAGG - Intergenic
1031479146 7:122257354-122257376 TCCTGAAGGGTGGCGTGGCCAGG + Intergenic
1034034076 7:147801846-147801868 CCCAGACGGGGGGGGCGGCCGGG + Intronic
1034840080 7:154387491-154387513 CCCAGCAGGTGGGTGGGCCCAGG + Intronic
1034982024 7:155485184-155485206 TCCAGAGCAGGGCTGGGGCCAGG + Intronic
1035019894 7:155794574-155794596 CTCAGGAGGGGGGTGGGGGCAGG + Intergenic
1035055993 7:156037112-156037134 ACAAGAAGGGGAGTGAGGCCAGG + Intergenic
1035203408 7:157280245-157280267 TCCAGAAAGGGGGAGCCGCCCGG + Intergenic
1035469424 7:159100136-159100158 TCAGGGAGGGCGGTGGGGCCAGG + Intronic
1035707755 8:1690059-1690081 TCAAGAGAGGGTGTGGGGCCGGG + Intronic
1035709320 8:1700369-1700391 TCCAGAAGGGGAGACGGGGCAGG + Intronic
1036270962 8:7302479-7302501 TCATGAAGGTGGGTGGGGGCTGG - Intergenic
1036350387 8:8007865-8007887 TCATGAAGGTGGGTGGGGGCTGG + Intergenic
1036687909 8:10924105-10924127 TCCAGCAGGGGAGAGGGCCCAGG - Intronic
1037524470 8:19711321-19711343 TCCTGCAGGAGGGTGGGGCAAGG + Intronic
1037583607 8:20261539-20261561 TGCAGAAGGGGGCTGGGGATGGG - Intronic
1037633494 8:20679046-20679068 CCAAGAAGAGAGGTGGGGCCGGG - Intergenic
1037835311 8:22211925-22211947 ACCAGCAAGGGGCTGGGGCCAGG + Exonic
1037881486 8:22575441-22575463 TCCAGAGGGGATGTGGGGCTGGG - Exonic
1037920626 8:22802996-22803018 TCCAGAAAGAGCTTGGGGCCAGG - Intronic
1038038709 8:23706598-23706620 TCCCGAAGGCGGATGGGGCGGGG + Exonic
1038462454 8:27728536-27728558 TCCAGAATGGGAGTGGAGGCTGG - Intergenic
1038593318 8:28861266-28861288 ACCAGATGGAGGGTGGGGACAGG - Intronic
1040387982 8:46926489-46926511 TCCAGTGGGGTGGTGGGGGCTGG - Intergenic
1040754654 8:50758466-50758488 TCAAGAGGTGGGGTGGGGCAGGG - Intronic
1040826561 8:51627743-51627765 CCCAGGATGGGGGTGGGGCAAGG - Intronic
1040900121 8:52410016-52410038 TCAAGAAAGGGGGAGGGGCGGGG + Intronic
1041103992 8:54424275-54424297 ACAAGAAGGAGGTTGGGGCCCGG - Intergenic
1041956265 8:63560202-63560224 TCCAGGAGTGGGGAGAGGCCAGG + Intergenic
1042303567 8:67310952-67310974 TCCAGGAGGGAGGTGGGGCCCGG + Intronic
1042712507 8:71734049-71734071 TTCAGAAGGGGGGTGGGGTTGGG - Intergenic
1043087299 8:75850078-75850100 TCCAGCAGGGAGGTGTGGCCAGG - Intergenic
1044741518 8:95332240-95332262 TCCTGCAGTGGGGTGGGGCCTGG + Intergenic
1044842196 8:96346034-96346056 TCAAGAAGGAGGCTGTGGCCTGG + Intergenic
1045417290 8:101980046-101980068 GCCAAAATGGGGGTGGGGGCAGG + Intronic
1046609008 8:116403603-116403625 TACATAAGGGGGCTGGGGGCTGG - Intergenic
1047687553 8:127317064-127317086 TCCAGGAGGGAGGTGGGGGGGGG + Intergenic
1048791534 8:138108775-138108797 GCCAGAATGGGGGTGGGGGTGGG - Intergenic
1048857226 8:138695494-138695516 TCTAGAAAGGGGTTGGAGCCAGG - Intronic
1049270291 8:141692072-141692094 TCAAGAAGGGTGCTTGGGCCAGG - Intergenic
1049447670 8:142638861-142638883 TCCAGAGTGGGGCTGAGGCCTGG - Intergenic
1049512900 8:143038773-143038795 GCCAGACGGGCGGTGGGGCGGGG - Intergenic
1049625402 8:143617543-143617565 GCCAGGTGGGGGGCGGGGCCGGG + Exonic
1049714834 8:144084951-144084973 TCCTGATGGGGGGTGGGGTACGG + Intronic
1050293534 9:4181219-4181241 TCCAGCAGATGGGTGGGGCCTGG - Intronic
1050544937 9:6701760-6701782 TCAAGAAGGCAGTTGGGGCCAGG + Intergenic
1051148705 9:14058045-14058067 ACCAGAACGGGGGTGGAGGCAGG + Intergenic
1052339812 9:27354039-27354061 TCCAGCAGGGAGGGGGAGCCTGG - Intronic
1053197182 9:36128296-36128318 ACAAGAAGGGGCATGGGGCCTGG - Intergenic
1053509807 9:38678109-38678131 TCCATGAGGAGGGTGGGGACAGG + Intergenic
1054762045 9:69012762-69012784 GGCAGAAGGGGGCTGGGGCAAGG + Exonic
1056163610 9:83921528-83921550 GCCAGGATGGGGGCGGGGCCAGG - Intergenic
1057039409 9:91836648-91836670 CCCAGACCGGGGGTGGGGCAGGG - Intronic
1060190121 9:121587309-121587331 TCAAGAATGGGGTTGAGGCCAGG + Intronic
1060996349 9:127876658-127876680 ACCAGGAGGGGGGCGGGGCAGGG - Intronic
1061297894 9:129686875-129686897 TCCAGCGGGGGAGTGGGGTCTGG + Intronic
1061454415 9:130686951-130686973 TCAAGAAGTGGGGTCTGGCCAGG - Intergenic
1061562964 9:131418273-131418295 TCCAGAAGGAAGAGGGGGCCAGG - Intronic
1061913792 9:133738618-133738640 TCCAGCAGGCAGGTGGTGCCTGG - Intronic
1061952629 9:133944806-133944828 TGCAGGAGGAGCGTGGGGCCGGG + Intronic
1062054306 9:134463051-134463073 TCCAGAGGTGGGGCAGGGCCGGG - Intergenic
1062214949 9:135384142-135384164 TCCAGAGGGGGGCTGGGCTCTGG + Intergenic
1062252429 9:135605049-135605071 ACCAGAAGGGAGGCGGGACCTGG - Intergenic
1062254805 9:135615841-135615863 GCCGGAAGGGGTGTGGGCCCAGG - Intergenic
1062524175 9:136971651-136971673 CCAAGAAGGGGGGTGAGCCCTGG - Exonic
1062683672 9:137798984-137799006 TGGAGAATGGGGGTGGGACCAGG - Intronic
1203364904 Un_KI270442v1:248485-248507 TCCATATTGGGGCTGGGGCCAGG + Intergenic
1185641711 X:1592229-1592251 TCCAGGAGGGTGGTGGGGAGCGG + Intronic
1186408093 X:9321479-9321501 TCAAGAAGGAAAGTGGGGCCTGG + Intergenic
1186897393 X:14017646-14017668 TCCAGAAGGTGGGAGAGGCCTGG - Intronic
1187768196 X:22666532-22666554 AACAGAATGGGGGTGGGGGCGGG - Intergenic
1187889435 X:23920376-23920398 TCCAGAAGGGGGATCTTGCCAGG - Intronic
1189812618 X:44794609-44794631 GAGAGAAGTGGGGTGGGGCCAGG - Intergenic
1190247446 X:48699969-48699991 TCCAGAAAAGGGGTGGGGTGGGG + Intronic
1190755980 X:53402568-53402590 GCCAGGCGGGGGTTGGGGCCAGG + Intronic
1192274473 X:69615933-69615955 TCCAGCCGCGGGGCGGGGCCTGG - Intergenic
1193915411 X:87356909-87356931 TGGAGTAGGGGGGTGGGGCATGG + Intergenic
1196607218 X:117670973-117670995 TTCAGAAGATGGGTAGGGCCAGG - Intergenic
1199721809 X:150547694-150547716 TCCAGTAGCGGGGCAGGGCCCGG + Intergenic
1200104152 X:153703154-153703176 TTCCGAAGGGGCGTGTGGCCAGG - Intronic
1200137097 X:153880469-153880491 GCCAGAGTGGGGGTGGGGCTGGG + Intronic
1200232541 X:154451211-154451233 TCCAGATCGGGGGTAGGTCCAGG + Intergenic
1202379128 Y:24260982-24261004 GAGAGAAGGGAGGTGGGGCCGGG - Intergenic
1202491654 Y:25409139-25409161 GAGAGAAGGGAGGTGGGGCCGGG + Intergenic