ID: 1160516878

View in Genome Browser
Species Human (GRCh38)
Location 18:79483601-79483623
Sequence CCGGCGTGACCTCGTTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 9, 2: 18, 3: 14, 4: 45}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160516864_1160516878 27 Left 1160516864 18:79483551-79483573 CCTGGTCCTGGGGTGTCACTCCG 0: 2
1: 10
2: 11
3: 12
4: 130
Right 1160516878 18:79483601-79483623 CCGGCGTGACCTCGTTCCTGGGG 0: 1
1: 9
2: 18
3: 14
4: 45
1160516874_1160516878 -9 Left 1160516874 18:79483587-79483609 CCTGGGGCGTCACTCCGGCGTGA 0: 1
1: 6
2: 12
3: 22
4: 59
Right 1160516878 18:79483601-79483623 CCGGCGTGACCTCGTTCCTGGGG 0: 1
1: 9
2: 18
3: 14
4: 45
1160516872_1160516878 -2 Left 1160516872 18:79483580-79483602 CCTGGTTCCTGGGGCGTCACTCC 0: 1
1: 4
2: 10
3: 24
4: 138
Right 1160516878 18:79483601-79483623 CCGGCGTGACCTCGTTCCTGGGG 0: 1
1: 9
2: 18
3: 14
4: 45
1160516866_1160516878 21 Left 1160516866 18:79483557-79483579 CCTGGGGTGTCACTCCGGCGTGA 0: 4
1: 13
2: 23
3: 29
4: 42
Right 1160516878 18:79483601-79483623 CCGGCGTGACCTCGTTCCTGGGG 0: 1
1: 9
2: 18
3: 14
4: 45
1160516870_1160516878 7 Left 1160516870 18:79483571-79483593 CCGGCGTGACCTGGTTCCTGGGG 0: 16
1: 19
2: 9
3: 15
4: 196
Right 1160516878 18:79483601-79483623 CCGGCGTGACCTCGTTCCTGGGG 0: 1
1: 9
2: 18
3: 14
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160516878 Original CRISPR CCGGCGTGACCTCGTTCCTG GGG Intronic
900480255 1:2894731-2894753 CCACCCTGACCTCCTTCCTGGGG + Intergenic
907922885 1:58929701-58929723 CCTGCTTTACCTCCTTCCTGAGG - Intergenic
915287932 1:154864725-154864747 CCTGCCTGGCCTCGTTGCTGGGG - Intronic
1067702618 10:48584576-48584598 CATGCGTGTCCTCGTTACTGTGG + Intronic
1070279527 10:75038437-75038459 CTGGCATGACCGCGCTCCTGGGG + Intronic
1077236933 11:1486362-1486384 CCACCCTGACCTCCTTCCTGGGG + Intronic
1083397172 11:62400036-62400058 CCTGCGTGACCTCATTCTGGAGG - Intergenic
1083492586 11:63023851-63023873 GCGGCGTGACCTCCAACCTGTGG - Intergenic
1083928086 11:65821292-65821314 CCTGCGTGTCCTCCTTCCTCTGG - Intergenic
1085396463 11:76209375-76209397 CCGGCGTGGCCTGGTCCCAGCGG - Intronic
1085784201 11:79437384-79437406 CCGGCCCGGCCGCGTTCCTGCGG - Intronic
1091752494 12:3031577-3031599 CCAGGGTGACCTCTGTCCTGTGG + Intronic
1102862084 12:116344773-116344795 CTGGCTTGACCCAGTTCCTGGGG - Intergenic
1104388354 12:128370537-128370559 CCTGCTTGACCCCTTTCCTGAGG - Intronic
1108592870 13:51926285-51926307 CCGCAGTGACCTCCTTGCTGTGG + Intergenic
1111935061 13:94549487-94549509 GCGGCGCGGCCTCGCTCCTGGGG + Intergenic
1129313137 15:74725987-74726009 CCGTGGTGACCTCCTTCCCGGGG + Intergenic
1136517255 16:30775524-30775546 CCGGCCTGAACTGGATCCTGCGG + Exonic
1147557058 17:41486320-41486342 CAGGGGTGTCCTCCTTCCTGTGG + Exonic
1151972542 17:77466307-77466329 CGGGCCTGACCACTTTCCTGAGG - Intronic
1152196442 17:78921217-78921239 CAAGGGTGACCTGGTTCCTGGGG - Intronic
1154191768 18:12236230-12236252 ACTCCGTGTCCTCGTTCCTGTGG - Intergenic
1160516468 18:79481800-79481822 CCAGCGTGACCTGGTTCCTGAGG + Intronic
1160516475 18:79481830-79481852 CCAGCGTGACCTGGTTCCTGGGG + Intronic
1160516481 18:79481860-79481882 CCAGCGCGACCTTGTTCCTGGGG + Intronic
1160516501 18:79481948-79481970 CCAGCATGACCTGGTTCCTGGGG + Intronic
1160516515 18:79482007-79482029 CCAGTGTGACCTGGTTCCTGGGG + Intronic
1160516521 18:79482037-79482059 CCAGCGTGAGCTGTTTCCTGGGG + Intronic
1160516525 18:79482067-79482089 CCAGCATGACCTGGTTCCTGAGG + Intronic
1160516538 18:79482126-79482148 CCAGCATGACCTCGTTCCTGGGG + Intronic
1160516552 18:79482185-79482207 CCAGCATGACCTGGTTCCTGGGG + Intronic
1160516562 18:79482244-79482266 CCAGCGTGACCTCGTTCCTGGGG + Intronic
1160516569 18:79482274-79482296 CCAGTGTGACCTGGTTCCTGGGG + Intronic
1160516576 18:79482304-79482326 CCAGCGTGACCTGGTTCCTGGGG + Intronic
1160516596 18:79482392-79482414 CCAGCATGACCTGGTTCCTGGGG + Intronic
1160516610 18:79482451-79482473 CCAGCGTGACCTGGTTCCTGGGG + Intronic
1160516627 18:79482540-79482562 CCAGCGTGACCTGGTTCCTGAGG + Intronic
1160516641 18:79482599-79482621 CCAGCATGACCTGGTTCCTGGGG + Intronic
1160516647 18:79482629-79482651 CCAGCGTGACCTCGTTCCTGGGG + Intronic
1160516661 18:79482688-79482710 CCAGCATGACCTGGTTCCTGGGG + Intronic
1160516671 18:79482747-79482769 CCAGCGTGACCTCGTTCCTGGGG + Intronic
1160516699 18:79482864-79482886 CCAGCGTGACCTGGTTCCTGGGG + Intronic
1160516712 18:79482923-79482945 CCAGCGTGACCTCGTTCCTGGGG + Intronic
1160516719 18:79482953-79482975 CCAGCGTGACCTGGTTCCTGGGG + Intronic
1160516751 18:79483097-79483119 CCAGCGTGACCTGGTTCCTGGGG + Intronic
1160516758 18:79483127-79483149 CCAGCGTGACCTGGTTCCTGGGG + Intronic
1160516765 18:79483157-79483179 CCAGCGTGACCTGGTTCCTGGGG + Intronic
1160516772 18:79483187-79483209 CCAGCGTGACCTGGTTCCTGGGG + Intronic
1160516801 18:79483304-79483326 CCGGCGTGACCTGGTTCCTGGGG + Intronic
1160516809 18:79483334-79483356 CCGGCATGACCTGGTTCCTGGGG + Intronic
1160516817 18:79483364-79483386 CCGGCGTGACCTGGTTCCTGGGG + Intronic
1160516825 18:79483394-79483416 CCGGCATGACCTGGTTCGTGGGG + Intronic
1160516839 18:79483453-79483475 CCAGCGTGACCTGGTTCCTGGGG + Intronic
1160516847 18:79483483-79483505 CCGGCGTGACCTGGTTCCTGGGG + Intronic
1160516871 18:79483571-79483593 CCGGCGTGACCTGGTTCCTGGGG + Intronic
1160516878 18:79483601-79483623 CCGGCGTGACCTCGTTCCTGGGG + Intronic
1160516897 18:79483689-79483711 CCAGCGTGACCTTGTTCCTGGGG + Intronic
1160516908 18:79483748-79483770 CCAGCGTGACCTCGTTCCTGAGG + Intronic
1160516912 18:79483778-79483800 CCAGTGTGACCTCGTTCCTGAGG + Intronic
1160516926 18:79483837-79483859 CCAGCGTGACGTGGTTCCTGGGG + Intronic
1160516932 18:79483867-79483889 CCAGCGTGACGTGGTTCCTGGGG + Intronic
1160516938 18:79483897-79483919 CCAGCGTGACCTGGTTCCTGGGG + Intronic
1160516945 18:79483927-79483949 CCAGCGTGACCTGGTTCCTGGGG + Intronic
1160516966 18:79484015-79484037 CCAACGTGACCTGGTTCCTGGGG + Intronic
1160980034 19:1812458-1812480 CGGCCGTGACCGCGTCCCTGAGG - Intergenic
1161226813 19:3150710-3150732 CAGGGGTGACCCTGTTCCTGGGG + Intronic
1161226919 19:3151052-3151074 CTGGGGGGACCTTGTTCCTGGGG + Intronic
1161226966 19:3151220-3151242 CTGGAGTGACCCTGTTCCTGGGG + Intronic
1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG + Intronic
1170589553 20:17761493-17761515 CCTCTGTGACCTCCTTCCTGGGG + Intergenic
1172034038 20:31999483-31999505 CCCTCGAGGCCTCGTTCCTGAGG - Exonic
1185206658 22:49542870-49542892 CCTCTGTGACCTCTTTCCTGAGG - Intronic
951136818 3:19113477-19113499 CCACTGTGACCTCTTTCCTGAGG + Intergenic
983022904 4:162700671-162700693 CCTGCATGACCACATTCCTGGGG - Intergenic
992090428 5:73311743-73311765 CCCGCGAGACCGCGTTCCAGTGG - Intergenic
1005042558 6:21612218-21612240 CCTGCGTGGCTTGGTTCCTGGGG + Intergenic
1007925833 6:45648961-45648983 CCTGCCAGACCTGGTTCCTGAGG - Intronic
1011603609 6:89081422-89081444 GCGGCCTCACCTCTTTCCTGAGG - Exonic
1025206082 7:56994054-56994076 CCCCCGTGGCCTCGCTCCTGCGG + Intergenic
1040409043 8:47136122-47136144 CCGGCCTGAACTCTTTCCTTTGG + Intergenic
1040554949 8:48470039-48470061 CCAGCCTGACCTCCTTCTTGGGG - Intergenic
1048208490 8:132434848-132434870 CCGGGGTCACCTCCTTTCTGAGG - Intronic
1049054561 8:140225638-140225660 TCCGCTTGACCTGGTTCCTGGGG - Intronic
1050694108 9:8260206-8260228 CCGGCGTGTGCTCGCTCATGGGG - Intergenic
1062359712 9:136181977-136181999 CCGGCTTGTCCTCCTTCCTGGGG + Intergenic
1197997000 X:132388100-132388122 ATGCCATGACCTCGTTCCTGTGG + Intronic
1198024877 X:132695039-132695061 CCAGCGCCACCTCGTCCCTGGGG - Intronic