ID: 1160518196

View in Genome Browser
Species Human (GRCh38)
Location 18:79489891-79489913
Sequence CGGTGCCGCTTCGGGGGTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160518182_1160518196 26 Left 1160518182 18:79489842-79489864 CCTGGGAGCAGCCACACACAAGC 0: 1
1: 0
2: 2
3: 20
4: 240
Right 1160518196 18:79489891-79489913 CGGTGCCGCTTCGGGGGTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 74
1160518186_1160518196 15 Left 1160518186 18:79489853-79489875 CCACACACAAGCTTTCGGGGTTA 0: 2
1: 0
2: 0
3: 4
4: 50
Right 1160518196 18:79489891-79489913 CGGTGCCGCTTCGGGGGTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160518196 Original CRISPR CGGTGCCGCTTCGGGGGTCG GGG Intronic
901752497 1:11419424-11419446 CGGGGCCTGTTGGGGGGTCGGGG - Intergenic
903069102 1:20717828-20717850 CGGGGCCGCGGCGGGGGGCGGGG + Exonic
905202144 1:36322576-36322598 GGGTGCTGCTGCGGGGGTCCCGG + Exonic
906797850 1:48711806-48711828 GGGTGCTGCTTCTGGGGTCCAGG - Intronic
1073759245 10:106612398-106612420 CGGTCACGCTGCGGGGGTGGGGG - Intronic
1077213293 11:1383272-1383294 CGGTGCCGGTGCGGGGATCAGGG + Intergenic
1077409169 11:2395519-2395541 CGGTGCGGCCCCGGGGGGCGAGG + Exonic
1083682814 11:64359129-64359151 TGGTGCCGCCTCCGGGGCCGAGG - Intronic
1083922433 11:65787869-65787891 CGATGCCACTTTGGGGGGCGGGG + Intronic
1090262991 11:125335070-125335092 AGGTGCCGCTTTGGGGCTCAAGG - Intronic
1091131828 11:133153043-133153065 CGGTGCCCCTTCCAGGGTCCAGG - Intronic
1097033282 12:56104828-56104850 GAGTGCGGCCTCGGGGGTCGGGG + Intronic
1103562762 12:121800778-121800800 GGGGGCCGTTTCGGGGGCCGTGG - Intronic
1106686906 13:32069866-32069888 CGGGGCCTCTTGGGGGGTGGGGG - Intronic
1120091849 14:80341365-80341387 TGGGGCCGGTTCGGGGGTGGGGG + Intronic
1132656694 16:1044478-1044500 CGGGGCCGCCTGGGGGGCCGAGG + Intergenic
1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG + Intronic
1135291619 16:21244251-21244273 CGGGGCCTGTTGGGGGGTCGGGG + Intronic
1142141482 16:88474566-88474588 CCGTCCCACTTCGGGGGGCGGGG + Intronic
1142148361 16:88502030-88502052 TGGAGCCGCGTCGGGGGTGGAGG - Intronic
1142367242 16:89657039-89657061 GGGTCCCGAATCGGGGGTCGGGG + Intronic
1142596276 17:1031537-1031559 CGGGGGCGCTGCGGGGCTCGGGG - Intronic
1142670873 17:1486873-1486895 CGAGGCCGCTTCGGAGGTGGGGG - Intronic
1146720442 17:35119848-35119870 CGCTGCCGCTTCCGGGTTCCAGG + Intronic
1147123706 17:38351950-38351972 CGCTGTCGCTCCGGGGGCCGCGG + Intergenic
1151314126 17:73311543-73311565 GGGTGCCGCTGAGGGGGTTGGGG - Intronic
1153373177 18:4343637-4343659 TGGTGCCTGTTGGGGGGTCGGGG + Intronic
1155299503 18:24416486-24416508 CGGGGCTGCTTCTGGTGTCGGGG + Intergenic
1160518196 18:79489891-79489913 CGGTGCCGCTTCGGGGGTCGGGG + Intronic
1160680039 19:408314-408336 TGGAGCGGCTTCGGGGGTCTGGG - Exonic
1162033250 19:7926178-7926200 CGGGGCCGCCGCGGGGGGCGGGG + Intergenic
1165266627 19:34667031-34667053 CTGTCCCTCCTCGGGGGTCGTGG - Intronic
1167145813 19:47680456-47680478 CGGGGCCGCTCCGGTGGTGGTGG - Exonic
1167501566 19:49851368-49851390 GGGGGCCCCCTCGGGGGTCGCGG + Exonic
927512952 2:23655911-23655933 CGGTGCATCTTTGGGGGTCCAGG - Intronic
932292690 2:70595720-70595742 CGGGGCCTGTTCGGGGGTGGTGG + Intergenic
942414493 2:175744864-175744886 CTGTGCTGCTTCCGGGGCCGGGG - Intergenic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
1179030887 21:37718654-37718676 CGGTGCCTGTTAGGGGGTGGGGG + Intronic
1180064382 21:45405280-45405302 AGATGCGGCTGCGGGGGTCGCGG + Intronic
1180840567 22:18957060-18957082 CGGAGCGTCTTCGGGGGTGGGGG + Intergenic
1182424687 22:30265908-30265930 CGGTGCCCCGTTGGGGGTGGTGG - Intronic
1184101626 22:42344070-42344092 CGGTGCCGCTGCTGGGGGTGAGG + Intergenic
1185055357 22:48576105-48576127 CGGTGCGGCTCCGGGGGCGGCGG + Intronic
1185329252 22:50244861-50244883 GGGTGCCACTCCGAGGGTCGTGG + Intronic
950675217 3:14550500-14550522 CGGTGCCGCTGCGGGGAGGGTGG - Intergenic
961762677 3:129183431-129183453 CCCTGACGCTTCGAGGGTCGCGG - Intronic
964653152 3:159034383-159034405 TGGGGCCTGTTCGGGGGTCGGGG - Intronic
968372783 4:11132-11154 CGGCGCCGGGGCGGGGGTCGGGG + Intergenic
968372796 4:11181-11203 CGGCGCCGGGGCGGGGGTCGCGG + Intergenic
970330434 4:14977288-14977310 CGGGGCCTCTTGGGGGGTTGGGG - Intergenic
973531864 4:51843422-51843444 CGGTGACGCTGCGGGCGGCGTGG + Intronic
977908146 4:102501132-102501154 CGGGGCCGCTTCGGGGCGCCGGG - Intergenic
980359028 4:131745701-131745723 CGGTTCCGGTTTGGGGGTCTGGG + Intergenic
985462611 4:190121434-190121456 CGGCGCCGGGGCGGGGGTCGGGG - Intergenic
985629855 5:1008750-1008772 CGGGGGCGCTGCGGGGGCCGCGG + Intergenic
988350949 5:30106623-30106645 CTCTGGGGCTTCGGGGGTCGTGG + Intergenic
998265474 5:140664807-140664829 CGCTTCCGCCTCGGGGGGCGGGG - Exonic
1001488384 5:172136978-172137000 CGGGGCCTGTTCGGGGGTGGGGG - Intronic
1006834021 6:36986062-36986084 CGGAGCGGCGGCGGGGGTCGAGG - Exonic
1007444652 6:41895461-41895483 GGGTGCCGGTGCCGGGGTCGCGG - Intergenic
1019279591 7:193104-193126 CGGCGCCGCCTCGCGGGTCAAGG - Exonic
1019563052 7:1667380-1667402 GGGGGCAGCTTCGGGGGTTGTGG + Intergenic
1020076719 7:5263357-5263379 AGGTGGAGATTCGGGGGTCGAGG - Intergenic
1025202374 7:56970237-56970259 AGGTGGAGATTCGGGGGTCGAGG + Intergenic
1025669574 7:63606690-63606712 AGGTGGAGATTCGGGGGTCGAGG - Intergenic
1029537222 7:101163795-101163817 CAGCGCGGCCTCGGGGGTCGGGG - Exonic
1029919207 7:104244563-104244585 CGGGGCCTCTTGGGGGGTGGGGG - Intergenic
1041216046 8:55601193-55601215 CGGTGCCTCTTGTGGGGTGGGGG - Intergenic
1059416801 9:114167608-114167630 CTGTGCCCCTTAGGGGGTAGGGG + Intronic
1185464233 X:345767-345789 CGGGGCCGCTCCGTGGGTGGGGG + Intronic
1188826569 X:34842280-34842302 CGGGGCCTGTTCGGGGGTTGGGG + Intergenic
1195650689 X:107280568-107280590 CGGGGCCTGTTGGGGGGTCGGGG - Intergenic
1199010282 X:142750180-142750202 CGGGGCCGGTTGGGGGGTGGGGG - Intergenic
1199640439 X:149856113-149856135 TGGGGCCTGTTCGGGGGTCGGGG - Intergenic