ID: 1160519622

View in Genome Browser
Species Human (GRCh38)
Location 18:79497159-79497181
Sequence AAGAAGGACTGGAGAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 879
Summary {0: 1, 1: 0, 2: 4, 3: 77, 4: 797}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160519622 Original CRISPR AAGAAGGACTGGAGAGAAGC AGG Intronic
901508389 1:9701013-9701035 TGGAAGGACTGCGGAGAAGCAGG - Intronic
901649378 1:10734898-10734920 AACAATTACTGGAGAGAAGAGGG + Intronic
901661204 1:10798997-10799019 GAGAAGGAATGGAGAGAGGATGG - Intergenic
902921775 1:19670312-19670334 AATGAGGACTGGAGAGGACCTGG - Intronic
903283935 1:22265678-22265700 AAGGAAGGGTGGAGAGAAGCAGG - Intergenic
903468840 1:23570794-23570816 GAGAAAGACTGGAGGGAAGGGGG + Intergenic
904014803 1:27411123-27411145 AAGAATGAGGGGAGAGAAGGAGG + Intronic
904029908 1:27527640-27527662 AACCAGGACTGGAGAGACGCTGG + Intergenic
904197571 1:28797193-28797215 GAGAGAGACAGGAGAGAAGCGGG - Intergenic
904757905 1:32779235-32779257 AAAAAGGTCTGGAAAGAAGGAGG + Intronic
904775649 1:32904571-32904593 ATTATGGTCTGGAGAGAAGCAGG - Intergenic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
905564016 1:38948889-38948911 AAGAAGGAAAGGAGGGAAGGAGG + Intergenic
905809522 1:40901953-40901975 GAGAAGCAATGGGGAGAAGCTGG - Intergenic
906682430 1:47738488-47738510 AAACAGAACTGGAGAGAAGAAGG + Intergenic
907709307 1:56863874-56863896 AGGAAGGAAGGGAGAGAAGGAGG - Intronic
907790984 1:57663179-57663201 AAGAAGGAAGAGAGAGAAGGGGG + Intronic
907798546 1:57741801-57741823 AATTAGGACTGGAGAGACCCAGG + Intronic
908290996 1:62667150-62667172 AAGAATGACTAGAGAGAGGCAGG - Intronic
908341347 1:63182829-63182851 ATGAAGGACTGGGGAGATGTGGG + Intergenic
908694951 1:66829110-66829132 AAGAAGCTCTGGAGAGAAGATGG + Intronic
908800153 1:67871761-67871783 AACAAGGAGTTGAGAGAAGGGGG - Intergenic
909694443 1:78450207-78450229 GAGAAGGAAAGGAGAGAGGCTGG - Intronic
909819366 1:80041622-80041644 AAGGAGGACTTCTGAGAAGCTGG - Intergenic
910313796 1:85858707-85858729 AAGAAGGAAAGAAGGGAAGCAGG - Intronic
910576410 1:88769811-88769833 AAGAAGAAATGGGGAGAAGTTGG + Intronic
911257450 1:95648310-95648332 ATCAAGGACTGGAAAGATGCAGG - Intergenic
912016124 1:105038840-105038862 AAGAAGGGTAGGAGAGAAGCTGG + Intergenic
912050793 1:105525890-105525912 ATGAAGGACTTGAAAGAGGCAGG - Intergenic
912066909 1:105755998-105756020 AACAAGGACTTGAAAGATGCAGG + Intergenic
912259500 1:108096362-108096384 AGGACAGACTGGAGAGATGCAGG + Intergenic
913392005 1:118324507-118324529 AACAAAGACAGGAGAGAAACAGG - Intergenic
913404432 1:118473867-118473889 AAGAAGGACCAGAAAGAACCAGG - Intergenic
914314085 1:146492956-146492978 AAGAACATCTTGAGAGAAGCTGG - Intergenic
914340315 1:146754498-146754520 GAGAGGCACTGGTGAGAAGCAGG - Intergenic
914500262 1:148240424-148240446 AAGAACATCTTGAGAGAAGCTGG + Intergenic
915269576 1:154744045-154744067 AAGAATGACTCGGGAGAAGCTGG - Intronic
915288367 1:154867146-154867168 AGGGAGGACTGGAGAGAGCCAGG + Intronic
915626991 1:157120040-157120062 AATGAGGAGGGGAGAGAAGCAGG + Intergenic
915739480 1:158107689-158107711 AAGTAAGAATGGAGAGAAGGTGG - Intergenic
915923474 1:159996741-159996763 AAGAAGAACTAGAAAGAAGGTGG - Intergenic
915997392 1:160577221-160577243 GAGAAGCAGTGGAGAGATGCAGG - Intronic
916197535 1:162238424-162238446 CAGAAGGAATGGAGACTAGCAGG - Intronic
916285190 1:163098613-163098635 AACAAGGACTTGAAAGATGCAGG + Intergenic
916769932 1:167898302-167898324 AAGAATGATTGAAGAGAGGCTGG + Intronic
917200756 1:172512100-172512122 AAGAATGACAGGAGAAAAGATGG + Intergenic
917231685 1:172844739-172844761 AAGAAGGATGAGAGAGAAGAGGG + Intergenic
917554641 1:176070956-176070978 GAGAAGAATTGGACAGAAGCAGG - Intronic
918342943 1:183582206-183582228 AAGAAGGGCTAGAGGGAGGCGGG - Intronic
918443161 1:184588918-184588940 AAGCAGGACTGAGAAGAAGCCGG - Intronic
918521557 1:185420542-185420564 GAAAAGGACTGCAGGGAAGCCGG + Intergenic
919263271 1:195226440-195226462 AAGAAAGAAGGGAGGGAAGCAGG + Intergenic
919392978 1:197010589-197010611 AAGAAGGATGGGAGGGAAGGAGG + Intergenic
919920021 1:202162008-202162030 AGGACAGACTGGAGGGAAGCAGG + Intergenic
920155989 1:203951770-203951792 AAGAACCACTGGACAGAATCGGG + Intergenic
921131206 1:212221603-212221625 AAGAAGGGGAGGAGCGAAGCAGG - Intergenic
921285061 1:213602201-213602223 AAGAAGGAATGGAGGGAGGGAGG - Intergenic
921494033 1:215814507-215814529 ATGAAAGATTGGAGAGAAGTAGG + Intronic
921700454 1:218263368-218263390 AAGAAGAAGAGAAGAGAAGCTGG + Intergenic
922191550 1:223323224-223323246 AAGAAGGAAGGGAGAGAGGGAGG + Intronic
922499535 1:226086305-226086327 AAGGAGGATTGGTGACAAGCAGG - Intergenic
923093482 1:230756971-230756993 AAGAAGGAAGGGAGAGAGGGAGG + Intronic
923124806 1:231025744-231025766 AGGAAGGAAGGGAGAGAAGGAGG + Intronic
923362184 1:233222563-233222585 GAGAATGAATGGATAGAAGCAGG + Intronic
923484099 1:234412770-234412792 CAAAAGGACTGGTGATAAGCAGG + Intronic
923538548 1:234871526-234871548 CAGCAGGGCTGGGGAGAAGCAGG - Intergenic
923662917 1:235974068-235974090 AACAAGTACTGGAGAGCATCTGG - Intergenic
923692112 1:236204653-236204675 CAGAAGAACTGAAGAAAAGCTGG + Intronic
923692360 1:236207136-236207158 CAGAAGTACTGAAGAAAAGCTGG + Intronic
923706537 1:236348809-236348831 GAGAAGGACTGGAGAAAAGGTGG - Intronic
924002969 1:239574316-239574338 AAGAAGGAGAGGAGGGCAGCTGG - Intronic
1063087565 10:2833275-2833297 CAGGAGGACAGGAGAGAAGCAGG - Intergenic
1063675488 10:8137737-8137759 GAGAAGAAAAGGAGAGAAGCAGG + Intergenic
1063688022 10:8257088-8257110 AACCAGGACTGGAGACAAGGTGG + Intergenic
1063698004 10:8356441-8356463 AAGAAGGAAGGGAGGGAGGCAGG - Intergenic
1064018036 10:11787860-11787882 AAGAAAGACTGCAGAGAAAGAGG + Intergenic
1064210500 10:13357187-13357209 AGGAAGGAAGGGAGAGAAGGAGG - Intergenic
1064385946 10:14891662-14891684 AAGAAGGAATTGAGATAACCTGG + Intronic
1064460046 10:15525664-15525686 AAAAAGGAGTGAAAAGAAGCAGG + Intronic
1064517771 10:16169184-16169206 ATGAAGGACTTGAAAGATGCAGG - Intergenic
1064808934 10:19170953-19170975 AAGAAGGAGTAGAGAGTAGTAGG - Intronic
1065198100 10:23286476-23286498 AAGAAGGAAGGGAGGGAAGAAGG + Intronic
1065240059 10:23695464-23695486 AGGAGGGACTGGAGAGGAACCGG + Intronic
1065455714 10:25904754-25904776 AAGTAGGATTGGATAGAGGCAGG - Intergenic
1066177774 10:32927304-32927326 CAACAGGAGTGGAGAGAAGCAGG + Intronic
1066748291 10:38625256-38625278 AGGAAGGGTGGGAGAGAAGCGGG + Intergenic
1066968392 10:42292517-42292539 AGGAAGGGTGGGAGAGAAGCGGG - Intergenic
1067036835 10:42927043-42927065 TAGAAGGGCAGGGGAGAAGCCGG - Intergenic
1067234290 10:44435379-44435401 AAGCAGATCTGGACAGAAGCTGG - Intergenic
1067329914 10:45305620-45305642 AAGAAAGGCTGGAGAGGAGGTGG - Intronic
1068086071 10:52374931-52374953 AAGAAGGAATCTAGAGAAGCAGG + Intergenic
1068460895 10:57327000-57327022 GAGAAGGAAGAGAGAGAAGCAGG - Intergenic
1068766095 10:60765448-60765470 AAGAATGACAGAAGAGAAGAAGG + Intergenic
1069347561 10:67487817-67487839 AGGAAGGTCAAGAGAGAAGCTGG - Intronic
1069619494 10:69827910-69827932 AAGAAGGACCACAAAGAAGCGGG - Intronic
1069830449 10:71279433-71279455 ATGAGGAACTGGATAGAAGCCGG + Intronic
1070029179 10:72660736-72660758 AAGAATGAAAGGAGAGAAGATGG + Intergenic
1070481245 10:76884751-76884773 AAGAAGGAAGGAAGAGAAGAAGG + Intronic
1071092608 10:81936476-81936498 AAGATGGATGGGAGGGAAGCAGG + Intronic
1071468447 10:85961693-85961715 AAGAAGGGAGGGAAAGAAGCAGG - Intronic
1072130342 10:92488089-92488111 AAGAAGTACTGAAGTGAGGCCGG - Intronic
1072822009 10:98567538-98567560 AAGCTGGCCTGGAGGGAAGCAGG + Intronic
1073055327 10:100696510-100696532 AGGAAGGAAGGGAGAGAAGGAGG + Intergenic
1073564419 10:104522858-104522880 AAGCAGGAAGGGAGAAAAGCAGG + Intergenic
1073958537 10:108899633-108899655 AAGAAGTACAGGAAAGAAACAGG + Intergenic
1074067061 10:110025727-110025749 AAAAAGCACTGGACAGAGGCAGG - Intronic
1074595282 10:114858730-114858752 GAGGAGGAATGGAGAGAAGTTGG + Intronic
1074731824 10:116386493-116386515 AAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1075103216 10:119520090-119520112 AAGACGGGGTGGAGAGGAGCCGG - Intronic
1075105571 10:119538115-119538137 AAGAAGGAAGGGAGGGAAGGAGG + Intronic
1075188669 10:120286207-120286229 AGGTAGGACTGCAGAGAAACTGG + Intergenic
1075449537 10:122540171-122540193 AAGAAAGTCTGCAGAGAGGCAGG + Intergenic
1075553542 10:123412139-123412161 CAGAAGGAAGAGAGAGAAGCAGG - Intergenic
1075597648 10:123743799-123743821 AGACAGGACTGGAGAGAAGCAGG + Intronic
1075845548 10:125542422-125542444 AAGACTGAGTGGAGAGATGCAGG - Intergenic
1075963005 10:126585438-126585460 AAGAAGGAAAGGAGGGAAGAAGG + Intronic
1076018937 10:127054158-127054180 AAGAAGGACTCAGGAGAAGGGGG + Intronic
1076617027 10:131761900-131761922 AAGAAGAAATGGAAAGAAGGAGG + Intergenic
1077024407 11:432846-432868 CTGGAGGACTGGGGAGAAGCAGG + Intronic
1077211013 11:1370974-1370996 ACCAGGGACTGGAGGGAAGCTGG + Intergenic
1077272275 11:1686894-1686916 AGGGAGGAAGGGAGAGAAGCAGG - Intergenic
1077354037 11:2106538-2106560 AAGAAGGAAGGAAGAGAAGAAGG + Intergenic
1077842257 11:5987746-5987768 AAGAAGGAGTGGATATAAGAGGG - Intergenic
1078202205 11:9193573-9193595 AAGAAATGCAGGAGAGAAGCTGG + Exonic
1078901723 11:15648874-15648896 AAGATGGACTGCAAAGGAGCAGG - Intergenic
1078970976 11:16410796-16410818 AACAAGGACTGGAAATAAGCAGG + Intronic
1079188812 11:18260703-18260725 TAGTAAGACTGGAGAGAAGGTGG - Intergenic
1079389633 11:20010264-20010286 AAGAAGGACTGGGGGGAAAATGG + Intronic
1080109144 11:28546114-28546136 AAGAAGGACGAGAGAGAAGAGGG + Intergenic
1080215769 11:29838317-29838339 AGGATGGACTGGAGAAAAACAGG + Intergenic
1080377290 11:31727370-31727392 AAGGAGGACTTGGGAGAATCAGG + Intronic
1080671431 11:34382892-34382914 CAGAAGAACTGCAGAGATGCTGG + Intergenic
1081218912 11:40436538-40436560 AAGCAGGACAGGAGAGAGGCTGG - Intronic
1081296336 11:41394295-41394317 AGGAAGGTATAGAGAGAAGCTGG - Intronic
1081413281 11:42784857-42784879 AAGAAGGAAGGAAGAGAGGCAGG + Intergenic
1081517092 11:43843631-43843653 GAGAAGAACTGGAGAGGAGTTGG - Intronic
1081626544 11:44659354-44659376 AAGAAGGAACGGAGAGGAACAGG + Intergenic
1081828177 11:46079508-46079530 AACAAGGCCTGGAAAGAAGCTGG + Intronic
1082229766 11:49749079-49749101 ATGAAAGACTGGAGAGGAGATGG - Intergenic
1082631099 11:55543299-55543321 AAGAATGAAAGGAGAGAAGTGGG - Intergenic
1082717124 11:56627833-56627855 AAGAAGGACAGAAGAGAAAGTGG + Intergenic
1082783438 11:57303541-57303563 AAGAACCACAGGAAAGAAGCAGG - Intronic
1082800962 11:57414603-57414625 AAGAAAGACAGGTGAGATGCGGG - Exonic
1083400196 11:62418255-62418277 AAGAAGGAATGGCCAGAAGAAGG + Intronic
1083487016 11:62989651-62989673 AAGCAGCAATGGAGAGAAGGAGG + Intronic
1083676713 11:64330012-64330034 AACAAGGAGTGGAGTGGAGCCGG + Intergenic
1083718849 11:64594013-64594035 AAGGAGCACTTGAGAGGAGCAGG - Intronic
1083929406 11:65832341-65832363 GAGATTGAGTGGAGAGAAGCTGG - Intronic
1083929433 11:65832677-65832699 GAGATGGAGTGGAGAGAAGCTGG - Intronic
1084078468 11:66801321-66801343 AATAAGGCCTGAAGAGAAGAAGG - Intronic
1084538567 11:69773478-69773500 AAGAAGGGCTGCAGCAAAGCAGG + Exonic
1084601566 11:70148891-70148913 AAGAAGGTCCCGAGAGGAGCTGG + Intronic
1084762365 11:71282170-71282192 AAGGAACACTGGACAGAAGCTGG + Intergenic
1086516032 11:87614323-87614345 AACAAGGAGAGGACAGAAGCTGG - Intergenic
1086614065 11:88793755-88793777 AAGAAGGATCTGAAAGAAGCAGG + Intronic
1086620310 11:88880046-88880068 ATGAAAGACTGGAGAGGAGATGG + Intronic
1087592964 11:100215684-100215706 AAGCAGAAATGAAGAGAAGCTGG + Intronic
1087649820 11:100852127-100852149 GAGGAGGACAGGAGAGAAGAGGG - Intronic
1087884633 11:103464206-103464228 AAGAACTTCTGGAGAGAAACAGG + Intronic
1088392121 11:109326018-109326040 AAGAAAGACTGGAGTGCATCTGG + Intergenic
1088453434 11:110007540-110007562 AAGAAGGAAGGGAGGGAAGGAGG + Intergenic
1088756513 11:112889742-112889764 ACAGAGGTCTGGAGAGAAGCTGG + Intergenic
1089302015 11:117504567-117504589 AAGGTTGACTGGTGAGAAGCAGG + Intronic
1089389117 11:118088002-118088024 AGGAAGAGCTGGAGAGATGCTGG + Intronic
1089401081 11:118165083-118165105 GAGGAGGAGTGGAGGGAAGCAGG - Exonic
1089685631 11:120144963-120144985 GAGAAGGACTGGAGACAGCCTGG + Intronic
1089738880 11:120568359-120568381 AAGAATGCCTGGAAAGAAGGTGG - Intronic
1090226188 11:125073491-125073513 AAGAAGGACTGGAGGGGTGGAGG - Intronic
1090627090 11:128617067-128617089 AAGAAGCACAGGACAAAAGCAGG + Intergenic
1090718212 11:129449352-129449374 ATGGAGTAATGGAGAGAAGCAGG + Intronic
1091176228 11:133560600-133560622 ACGTCTGACTGGAGAGAAGCTGG - Intergenic
1091692818 12:2608723-2608745 AGGAAGGAGCGGAGGGAAGCGGG + Intronic
1091845570 12:3653764-3653786 AAGAGGGACCAGAGGGAAGCAGG - Intronic
1091949591 12:4581745-4581767 GGGAAGGACAGGAGAGAGGCAGG - Intronic
1092028215 12:5261057-5261079 AAGCAGAAGTGGAGAGAAGAGGG + Intergenic
1092162643 12:6324385-6324407 AAGAAGAACTGGAAGGAAGCAGG - Intronic
1092203782 12:6603413-6603435 AGAAAGGAGTGGAGAGAAGAAGG + Intronic
1092352870 12:7770058-7770080 AAGCAGAAATGGAGAGAAGAAGG + Exonic
1094000950 12:25693457-25693479 ATGAAGGAAAGGAGAGAAGGAGG + Intergenic
1094330386 12:29285552-29285574 AAGAAGGAAGGGAGGGAAGGAGG + Intronic
1094341369 12:29415249-29415271 AAGAAGGGCTGAAAAGAAGGGGG + Intronic
1095605324 12:44060627-44060649 AAGTATGTCTGGAGAGGAGCAGG + Intronic
1095735225 12:45548714-45548736 AAGAAGGACTGGATAGGAGAAGG + Intergenic
1096284101 12:50283354-50283376 AAGAGGGTGTGGAGAGAAGCCGG + Intronic
1096571882 12:52528142-52528164 AAGAAGGGCTGGAGGAAATCAGG - Intergenic
1096919805 12:55071976-55071998 AAAAAGGTCTGGAGTGATGCAGG + Intergenic
1097053052 12:56235142-56235164 AAGCAGGGCTGGGGAGAATCAGG - Exonic
1097623480 12:61971050-61971072 AAGAAGAAGTGGAAAGAAGCTGG + Intronic
1097623804 12:61975285-61975307 AAGAAGGAATGGGGAGATGTAGG - Intronic
1097712800 12:62934313-62934335 AAGAGGGAGTGGGGAGAAGAGGG + Intronic
1097724040 12:63053892-63053914 AGGAAGGCCAGAAGAGAAGCAGG - Intergenic
1097829946 12:64213804-64213826 AAGAGGGACTGAAGAGGAACTGG - Intronic
1098501632 12:71199413-71199435 AGGAAGGACTAGAAAGAAGCAGG + Intronic
1098722476 12:73918444-73918466 AGGAAGGAATGGAAAGAAGGAGG - Intergenic
1098907990 12:76181048-76181070 AAGAAGGAAGGAAGAGAAGAAGG - Intergenic
1099188129 12:79538053-79538075 AAGAAGGCCTGGAAAGAAAAAGG + Intergenic
1099648552 12:85393880-85393902 AAGAAGGATTGGCTGGAAGCTGG - Intergenic
1099686268 12:85893140-85893162 AAGAAGGAGGGAAGAGAAACAGG + Intergenic
1100268626 12:93002334-93002356 AAGAAGACCTGTAGAAAAGCAGG - Intergenic
1100494467 12:95111575-95111597 AAGTAGGACTGGAGATGAGTGGG - Intronic
1100887822 12:99092076-99092098 AGAAAGGACTGGAGCAAAGCAGG - Intronic
1101503073 12:105321741-105321763 AAGAGGGTCTGGAGAGTAGCAGG + Intronic
1102208485 12:111106861-111106883 AAGAAGGACAGGGGACAACCTGG + Intronic
1102317238 12:111899069-111899091 CCGAAGGCCAGGAGAGAAGCAGG + Intergenic
1102409212 12:112702640-112702662 AAGAGTGACTGAAGAGAAGAGGG + Intronic
1102435207 12:112917507-112917529 GAGAGGGACAGGTGAGAAGCTGG - Intronic
1102484331 12:113245843-113245865 AAGATGCACTGGGGAGGAGCAGG - Intronic
1102563729 12:113780894-113780916 AAAAAAGAATGAAGAGAAGCTGG + Intergenic
1102601648 12:114035963-114035985 AAGAATGAGTCTAGAGAAGCTGG - Intergenic
1102705707 12:114878465-114878487 AAGAAGGAGGGAAGAGAAGGAGG - Intergenic
1102736032 12:115160481-115160503 AAGGAGGAATGGAGAGATGCTGG - Intergenic
1102900057 12:116629412-116629434 CAGAAGGAGAGGAGAGAAGGCGG + Intergenic
1103230192 12:119323583-119323605 AAGAAGGAAGGGAGGGAAGGAGG + Intergenic
1103282469 12:119771384-119771406 AGGAAGGACAGGAGAGGAGGGGG + Intronic
1103396399 12:120610472-120610494 AACAAGGACTTGAAAGATGCGGG + Intergenic
1103444393 12:120984704-120984726 AAGAAGGGAGAGAGAGAAGCTGG + Intronic
1103855008 12:123961315-123961337 AATAAGGACTGGAGTGAAAAAGG + Intronic
1104705844 12:130946805-130946827 AAGAAGGACTGGGGGCAGGCAGG - Intergenic
1105036238 12:132924393-132924415 AAGAAGCACTGGAAAGCAGCAGG - Exonic
1106471705 13:30061743-30061765 AAGAAAAAATGGAGAGAAGAGGG - Intergenic
1106670369 13:31898609-31898631 AAGATGGTGTGGAGAGCAGCAGG + Intergenic
1106790816 13:33153443-33153465 AAGAAGGACCAGAGAAACGCTGG + Intronic
1106815433 13:33402480-33402502 AAGATGGACTGGCTAGAAGAGGG + Intergenic
1107932072 13:45314951-45314973 AAGAAGGAAAGGAGAGGAGAGGG + Intergenic
1108802494 13:54116582-54116604 CACAAGGACTGGGGAGATGCTGG + Intergenic
1109966549 13:69706251-69706273 AAGAAGGAGTAGAGAAAAGAAGG - Intronic
1110042731 13:70785530-70785552 AGGAAAGACTGGAGAAAAGGAGG - Intergenic
1110392839 13:74995187-74995209 AAAAAGGGCTTGAGGGAAGCTGG - Intergenic
1110872773 13:80471820-80471842 AAGAAGGAATGGAGAGCAGTGGG - Intergenic
1111827559 13:93286801-93286823 AAGAAGGAAGGGAGAAAAGGAGG - Intronic
1111955985 13:94759056-94759078 GAGAAAGAAAGGAGAGAAGCAGG - Intergenic
1112158159 13:96840005-96840027 AAGAAGGAAAGGAGGGAAGGGGG + Intergenic
1112416304 13:99206086-99206108 GAGAGGGAATGCAGAGAAGCAGG + Intronic
1113024191 13:105922211-105922233 AAGAAGAAATGGAGGGAAGAGGG - Intergenic
1113207161 13:107930377-107930399 TAGAAGGACCCCAGAGAAGCAGG - Intergenic
1113665241 13:112136655-112136677 AAGAAGGAAGGGAGAGAGGGAGG - Intergenic
1114254287 14:20988633-20988655 AAGGAGGACTGAGGAAAAGCTGG + Intergenic
1114298911 14:21356272-21356294 AAGAAGCACTGGAAAGCAGTAGG + Intronic
1114593393 14:23890752-23890774 AAGAAGGAAGGGAGAGAGGAAGG + Intergenic
1114963860 14:27931736-27931758 AAGAAAGACTGGAGGAAAGAAGG - Intergenic
1115099634 14:29683124-29683146 AGGAAGGATTGCAGAGAAGATGG + Intronic
1115401002 14:32960258-32960280 AATGAGTTCTGGAGAGAAGCAGG + Intronic
1115440581 14:33430267-33430289 AAGAAGAACTGAAGGGAAGGCGG - Intronic
1116006552 14:39297818-39297840 AAGCAGGACTGGAAAAAAGGAGG - Intronic
1117174985 14:53136585-53136607 AAGAACCACTGGAAAGGAGCAGG + Intronic
1117738099 14:58787982-58788004 AAGAAAGAGAGGAGAGAAGTAGG - Intergenic
1117756148 14:58976120-58976142 AAGTAGGAGTGAGGAGAAGCTGG + Intergenic
1118884955 14:69858935-69858957 GAGATGGACTGGAGAATAGCAGG + Intronic
1119694709 14:76704041-76704063 AAGAAAGAGTGGAGAGAGCCTGG - Intergenic
1119998702 14:79279562-79279584 AAGAAGGACTGGAGGGAAAGAGG - Intronic
1120828660 14:88978421-88978443 AAGAAGAACTGAAGTGAAGAGGG + Intergenic
1121083683 14:91128641-91128663 GAGAAGGGCTGGAGAGTAACAGG - Intronic
1121183652 14:91947981-91948003 AAGAAGGGGTGGGGAGCAGCGGG + Intronic
1121655786 14:95594577-95594599 AGGAAGGAAATGAGAGAAGCTGG - Intergenic
1122002487 14:98671603-98671625 AAGAAAAACAGGAGAAAAGCAGG - Intergenic
1122088451 14:99322677-99322699 AAGAAGGTCTGGGAAGAGGCTGG + Intergenic
1122103126 14:99429398-99429420 AAGGAGCACTGGTGAGACGCAGG + Intronic
1122570468 14:102695500-102695522 AAGAAGGAAAGGAGGGAAGGAGG + Intronic
1122821193 14:104346008-104346030 AAGAGGGCCTGGAGGGAAGGAGG - Intergenic
1123097487 14:105773385-105773407 AAGCAGGGCTGGTGGGAAGCAGG - Intergenic
1123162459 14:106292058-106292080 AAGAAAGAGTGGCGAGAAGGAGG + Intergenic
1202918421 14_KI270723v1_random:6183-6205 GAGAAGGAGGGCAGAGAAGCTGG + Intergenic
1123982781 15:25619259-25619281 AAGCTGGAGTGGAGAGAAGCAGG - Intergenic
1124609648 15:31199898-31199920 AAGAAGGACGGGAAGGCAGCAGG - Intergenic
1125303899 15:38288477-38288499 AAGAAATAGTGGAGAGAAGGTGG + Intronic
1125397102 15:39261025-39261047 GAGAAGGAGAGGAGAGAAGAAGG + Intergenic
1125482564 15:40090736-40090758 AAAAAGGACTGGGGATAAGGGGG + Exonic
1126615211 15:50571235-50571257 TGGAAAGACTGTAGAGAAGCAGG + Intronic
1126846032 15:52761236-52761258 AAGTAAGACTGGACAGAAGGAGG - Intronic
1126978899 15:54218724-54218746 AAAATGGGCTGGAGAAAAGCTGG + Intronic
1127262350 15:57335557-57335579 AAGCAGGGCTGGAGAGCAGAGGG - Intergenic
1127374325 15:58369185-58369207 AAGGAGGCGTGGAGAGAAGTGGG - Intronic
1127730101 15:61792466-61792488 AAGAAGGACTGGGGAGACGTTGG - Intergenic
1128589319 15:68880732-68880754 AAGAAGGCCTGATGAGAAGGAGG + Intronic
1128877200 15:71212054-71212076 AGGAAGGAGTGGAGGGAGGCTGG + Intronic
1129933062 15:79428298-79428320 AGGAAGGAAGGGAGAGAAGAAGG - Intergenic
1130323858 15:82863042-82863064 AAGAAGCAGTGGAGAGAGGAGGG - Intronic
1130331920 15:82929279-82929301 AAAAAGGACCAGGGAGAAGCTGG + Intronic
1130522738 15:84675706-84675728 AAGAAGGAATAGAAAGCAGCAGG - Intronic
1130924669 15:88375941-88375963 AAGGAGGGATGGAGAGAAGGAGG - Intergenic
1131076388 15:89497709-89497731 AAGAGGGGCTGGAGGGGAGCAGG + Intergenic
1132841047 16:1978691-1978713 AGGATGGACTGGAGAGAGGCCGG - Exonic
1133702548 16:8322595-8322617 ATGAAGGGATGGAGAGAAGGTGG - Intergenic
1133844713 16:9443222-9443244 AGGAAGGAGAGGAGGGAAGCAGG + Intergenic
1134267732 16:12706447-12706469 AGGAAGGAAGGGAGAGAGGCAGG - Intronic
1134778482 16:16873491-16873513 AAGAGGGACTGGATAGATGTGGG + Intergenic
1135053886 16:19214539-19214561 AAGAAGGACTGAGAAGATGCTGG + Intronic
1135659558 16:24283152-24283174 AAGAAGGATAGCAGAGAAGAAGG - Intronic
1135728191 16:24873224-24873246 AGGAAGGAATGGAGAGAGGGAGG + Intronic
1136014700 16:27388623-27388645 AAGAAGGACAAGATGGAAGCTGG + Intergenic
1136039041 16:27563529-27563551 AAGAAAGACTGCAGGGAAGAGGG + Intronic
1136694289 16:32063327-32063349 AAGAAAGAGTGGTGAGAAGGAGG - Intergenic
1136734473 16:32452045-32452067 AGGAAGGGTGGGAGAGAAGCGGG - Intergenic
1136794786 16:33006590-33006612 AAGAAAGAGTGGTGAGAAGGAGG - Intergenic
1136875120 16:33847802-33847824 AAGAAAGAGTGGTGAGAAGGAGG + Intergenic
1136946065 16:34652585-34652607 AGGAAGGAAGGGAGAAAAGCAGG + Intergenic
1137033186 16:35543942-35543964 AGGAGGGAGTGGAGAGAACCAGG - Intergenic
1137256975 16:46783618-46783640 GGGAAGGACTGGAGAGAAAGGGG + Intronic
1137421970 16:48342546-48342568 TGGAAGGATTGGAGAGCAGCTGG + Intronic
1137484934 16:48882833-48882855 AAGAAGGGGTGCAGAGAAGAAGG - Intergenic
1137498303 16:48988901-48988923 AAGAAGGAATGGAGGGAAGGAGG - Intergenic
1137505502 16:49050807-49050829 AAGAAGCACTGGAAAGAGGGTGG + Intergenic
1137555740 16:49469248-49469270 ATGAAGGCCTGGAGAGAGGAGGG - Intergenic
1137891892 16:52171682-52171704 ATGAAGGCCTGCAAAGAAGCAGG - Intergenic
1138158690 16:54731775-54731797 AAGGAGGACTGGAGGGGAGGAGG - Intergenic
1138202555 16:55100972-55100994 AGGAAGGAATGGAGGGAAGAAGG + Intergenic
1138263098 16:55639727-55639749 AGGAAGGAAGGGAGAGAAGGAGG + Intergenic
1139016256 16:62692451-62692473 AGGAAGGACGGGAGGGAAGGAGG + Intergenic
1139044515 16:63040400-63040422 AAGAAGGACAGGAAAGAAGAAGG + Intergenic
1139245198 16:65434992-65435014 GAGCAGGACTGGACACAAGCTGG - Intergenic
1139421812 16:66853694-66853716 AGGAAGGACAGGAGCTAAGCAGG + Exonic
1139993973 16:70962910-70962932 GAGAGGCACTGGTGAGAAGCAGG + Intronic
1140206985 16:72941051-72941073 AAGAAGGCCTGGAGTGAACCAGG + Intronic
1140228389 16:73097047-73097069 AAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1140488144 16:75310736-75310758 AAGAGGTACTGGAAAGGAGCTGG + Intronic
1140551466 16:75870616-75870638 CAGAAGGAGAGGAGACAAGCAGG + Intergenic
1140731435 16:77860054-77860076 AAGACGGCGTGGAGAGACGCAGG + Intronic
1140763922 16:78138442-78138464 AAGGAGGACAGGAGTGAATCTGG + Intronic
1140951142 16:79818600-79818622 GAGAAGGTCTGGAGTGGAGCTGG - Intergenic
1140961573 16:79917962-79917984 CACAAAGCCTGGAGAGAAGCTGG - Intergenic
1141812341 16:86383804-86383826 AAGGAGGAAGGGAAAGAAGCAGG + Intergenic
1142135023 16:88447960-88447982 AAGAAGGAAGGGAGGGAAGAGGG + Intergenic
1142309494 16:89304067-89304089 CAGCAGGGCTGTAGAGAAGCTGG + Intronic
1203018607 16_KI270728v1_random:377557-377579 AGGAAGGGTGGGAGAGAAGCGGG + Intergenic
1203036942 16_KI270728v1_random:650715-650737 AGGAAGGGTGGGAGAGAAGCGGG + Intergenic
1203097049 16_KI270728v1_random:1268241-1268263 AAGAAAGAGTGGTGAGAAGGAGG - Intergenic
1142479801 17:212093-212115 AAAAAGAACAGGAGAGAAGATGG - Intergenic
1142817904 17:2442062-2442084 AAGAAGGAATGTGGAGAAGTTGG + Intronic
1142945448 17:3422650-3422672 TAGAGGGGCTGGAGAGAATCAGG - Intergenic
1142972386 17:3621583-3621605 GGGAAGGAATGGAGAGAAGGAGG - Intronic
1143179532 17:4975441-4975463 AAGAAGAAATGGAAAGAAGAGGG + Intronic
1143529457 17:7493759-7493781 TAGAAGGATTGGAGAGAGACAGG + Intronic
1143534235 17:7526368-7526390 AAGAAGGAGAGGAGAGGAGAGGG - Intergenic
1143604173 17:7971819-7971841 AACAAGGACTAGATAAAAGCAGG + Intergenic
1143652978 17:8275743-8275765 GAGAAAGACTGGAAAGAAGAGGG + Intergenic
1144375873 17:14640751-14640773 AAGAGGGAGAGGAGAGAGGCAGG - Intergenic
1144561045 17:16320443-16320465 AAGAAGGAAGGGAGGGAAGGAGG + Intronic
1144626270 17:16845845-16845867 GAGAAGGGCTGGAAAGAAGAGGG + Intergenic
1144880163 17:18426875-18426897 GAGAAGGGCTGGAAAGAAGAGGG - Intergenic
1145152071 17:20517509-20517531 GAGAAGGGCTGGAAAGAAGAGGG + Intergenic
1145840323 17:27988998-27989020 AGGAAGGAGTGGAGAGAAAGGGG + Intergenic
1146086340 17:29833730-29833752 AAGAAGGAAGGGAGGGAAGTAGG - Intronic
1146286052 17:31574831-31574853 AAGATGGGCTGGAGAGAGTCGGG + Intronic
1146466934 17:33093837-33093859 AATAAACACTGGAGAGAAGTAGG + Intronic
1146747737 17:35346759-35346781 AAGAATCACTGGAGAGATGAGGG - Intergenic
1146986197 17:37220915-37220937 AAGAAGAAATGGAGAGGGGCAGG + Intronic
1147133915 17:38424503-38424525 AACAAGGACTGGGAGGAAGCAGG - Intergenic
1147325906 17:39669523-39669545 AGGAAGAACTAGAGAGAGGCAGG + Intronic
1147446182 17:40476566-40476588 ATCAAGGAATGGAAAGAAGCTGG + Exonic
1147580417 17:41624539-41624561 GAGAAGGGCTGGAGAGGAGAGGG + Exonic
1148142816 17:45340391-45340413 GAGAAGGACTGGAGTGACTCTGG + Intergenic
1148284557 17:46375760-46375782 GAGAATGAGTGGAAAGAAGCAGG - Intergenic
1148306778 17:46593681-46593703 GAGAATGAGTGGAAAGAAGCAGG - Intronic
1148338703 17:46860234-46860256 AAGGAGGAGAGGAGGGAAGCGGG + Intronic
1148394662 17:47298542-47298564 AAGAAGGAAAGGAGAGATCCAGG - Intronic
1148563066 17:48617298-48617320 GAGGAGGAATGGAGAGAACCAGG + Intronic
1150826064 17:68476541-68476563 CAGAAGGACTGGTAAGAAGCTGG - Intergenic
1151317369 17:73331397-73331419 AAGAAGGAGAGGAGAGGAGAGGG - Intergenic
1151429460 17:74052664-74052686 AAGAAAGACGGGAGGGGAGCAGG - Intergenic
1151529146 17:74693279-74693301 TAGAAGGACAGAAGAAAAGCTGG + Intronic
1151608292 17:75154123-75154145 AGGAATGAATGGAGAGCAGCAGG + Intronic
1151938558 17:77279342-77279364 AAGAAGGACAAGAGAGAGGGAGG - Intergenic
1152003216 17:77660286-77660308 AAGAAGGAAAGGAGGGAAGAAGG - Intergenic
1153114618 18:1640240-1640262 ACAAAGGACAGGAGAGAAGAGGG - Intergenic
1153131404 18:1858689-1858711 AAAAAGGACTTGAAAGATGCAGG - Intergenic
1153948785 18:10039657-10039679 AAAGAGGATTAGAGAGAAGCTGG + Intergenic
1153992748 18:10414625-10414647 AGGAAGGATTACAGAGAAGCTGG - Intergenic
1154052728 18:10976819-10976841 AGGAAGGCCTGGAAAGAGGCAGG + Intronic
1154975273 18:21451445-21451467 AAGAAGGAAGGGAGGGAAGGAGG - Intronic
1155762150 18:29582085-29582107 AGGAAGGAAGGGAGAGAAGAAGG + Intergenic
1155763926 18:29603998-29604020 AAAAAGAATTGGAGAGAAGCAGG + Intergenic
1156623590 18:38882114-38882136 AAGAAGGAAGGGAGGGAAGGAGG + Intergenic
1156825249 18:41423340-41423362 AAGAGGGACTGGAGAAAAAAAGG - Intergenic
1157027758 18:43866947-43866969 AAGATTGACTGGTGAAAAGCTGG - Intergenic
1157452420 18:47798818-47798840 AAGAAGGAAGGGAGAGAGGGAGG + Intergenic
1157563204 18:48663123-48663145 AAGAAGGGCTGGAGGGCATCAGG + Intronic
1157580229 18:48769772-48769794 AATAAAGATTGGAGAAAAGCAGG - Intronic
1157629012 18:49078603-49078625 GAAAAGCACAGGAGAGAAGCTGG - Intronic
1157788482 18:50508022-50508044 CAGAAGGACAAGAGTGAAGCTGG - Intergenic
1157837097 18:50914851-50914873 AAGAAGGAAGGGAGAGAAGGAGG - Intronic
1157915184 18:51657421-51657443 AGGAAGGAATGGAAAGAAGGAGG - Intergenic
1157977410 18:52341850-52341872 AAGAAGGAGAGGAGAGCGGCTGG + Intronic
1158102263 18:53842614-53842636 GAGGAGGACTACAGAGAAGCAGG - Intergenic
1158966412 18:62625952-62625974 AAGAAGACCTGGGGAGAAGCTGG - Intergenic
1159283111 18:66312291-66312313 AAGAAGGAATGGAGGAAAGAAGG + Intergenic
1159283112 18:66312307-66312329 AAGAAGGAATGAAGAAAAGATGG + Intergenic
1159304227 18:66618389-66618411 ATCAAAGACTGGAGGGAAGCTGG - Intergenic
1159394434 18:67838124-67838146 AAGAAGGAAGGGAGAAAAGAAGG - Intergenic
1159424094 18:68261380-68261402 AAGGAGGCCTGGAGAGCAGCCGG - Intergenic
1159455922 18:68660147-68660169 ATCAAGGACTCGAGAGATGCAGG + Intergenic
1159598146 18:70403201-70403223 AAGAATTTCTGCAGAGAAGCTGG + Intergenic
1159682167 18:71368322-71368344 AGGGAGGACTGGGGAGAAGTAGG + Intergenic
1159728515 18:71994754-71994776 AAGAAGGATGGAAGAGAAGGTGG + Intergenic
1159915394 18:74183169-74183191 GAGGAGGAGTGGAGAGGAGCGGG - Intergenic
1160285748 18:77541386-77541408 AAGAAGCACTAGAGAAAACCGGG - Intergenic
1160426087 18:78780199-78780221 AAGAGGCGCTGGAGAGGAGCTGG - Intergenic
1160519622 18:79497159-79497181 AAGAAGGACTGGAGAGAAGCAGG + Intronic
1161621170 19:5298088-5298110 AAGAAAGACTGGAAGGAGGCCGG - Intronic
1161754153 19:6119386-6119408 AAGAAGGAATGGAGGGAAGGAGG - Intronic
1162338970 19:10080020-10080042 AAGAAGGAATGGAGGGAGGGAGG + Intergenic
1162452295 19:10762553-10762575 AGGGAGGAGGGGAGAGAAGCAGG + Intronic
1163094966 19:15050578-15050600 ATGAAGGAATGGATAGAAGGAGG + Intronic
1163142862 19:15362264-15362286 AACAAGGAGGGGAGTGAAGCAGG + Intronic
1163209866 19:15832269-15832291 AAGAAGGGCTGCAAAGAAGAAGG - Intergenic
1164761838 19:30734074-30734096 AACAAAGACGGGAGAGAAACAGG - Intergenic
1164816058 19:31204338-31204360 AGGAAGGACGGGAGGGAAGGAGG - Intergenic
1165184315 19:34003841-34003863 GAGTAGGACTGCAGAGAAACAGG - Intergenic
1165926067 19:39327120-39327142 GAGGAGGACTGGAGACAAGAGGG - Intergenic
1165934995 19:39383785-39383807 AGGAAGGAAAGGAGAGAGGCAGG - Exonic
1166513284 19:43425669-43425691 AAGAAGGAAGGGAGAGAGGGAGG + Intergenic
1166565474 19:43762840-43762862 AAGAAGGAGGGGAGAGCAGCAGG + Intergenic
1166758355 19:45208949-45208971 AAGGAGGACTGGGGAGACGGTGG + Intronic
1167084590 19:47300632-47300654 AGGAAGGAAAGGAGAGAAGGAGG - Intronic
1167716083 19:51143641-51143663 GAGAGGGGCTGGAGAGGAGCTGG - Intronic
1167852497 19:52212852-52212874 CAGAAGGACGGGAGAGCAGAGGG - Intronic
1167859423 19:52270794-52270816 AAGAAGGAATAGAGGGAAGAAGG + Intronic
1167958804 19:53089891-53089913 GAGAAGGAATGGAGGGAAGAAGG - Intronic
1168151481 19:54451195-54451217 TAGATGGACTCAAGAGAAGCCGG - Intronic
1168350320 19:55671773-55671795 AAGAAGGAATGGAGAGACCCTGG + Intronic
925194448 2:1911960-1911982 GAGAAGGCATGGAGAGCAGCCGG + Intronic
925651251 2:6091891-6091913 AAGATGGAATTGAGAGAAGGAGG - Intergenic
925730147 2:6914121-6914143 AAGAAGACCCGGAGAGTAGCAGG + Intergenic
925814260 2:7732369-7732391 AAGTGGGAATGGAGAGGAGCAGG - Intergenic
926105119 2:10145091-10145113 AAGGAGGCCTGGAGAGAGGAGGG + Intronic
926126873 2:10277438-10277460 ATGGAGGACGGGGGAGAAGCAGG + Intergenic
926425616 2:12736269-12736291 CAGAAGGACTGGGGTCAAGCAGG + Intronic
926425727 2:12737006-12737028 CAGAAGGACTGGGGCCAAGCTGG + Intronic
927258563 2:21062535-21062557 AAAAAGGAGAGGAGAGATGCAGG - Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
927716903 2:25358994-25359016 AATGAGGAATGGAGAGAAGCAGG - Intergenic
927799911 2:26088917-26088939 AAGAAAAACTGAAGATAAGCCGG - Intronic
927858504 2:26542767-26542789 AAGCAAGACTGGAGAGGGGCTGG + Intronic
928126478 2:28620126-28620148 AATATGGCCTGGAGAAAAGCCGG + Intronic
928660550 2:33497970-33497992 AAGAAGGGCTGGAGAAAGGGAGG - Intronic
928897779 2:36284636-36284658 AAAAATGAGTAGAGAGAAGCAGG - Intergenic
929541688 2:42827967-42827989 AAGAAGGTCTGGAGAGGAGGAGG + Intergenic
930363924 2:50415104-50415126 AGGAAGGACTTCATAGAAGCAGG + Intronic
930865760 2:56120662-56120684 AGAAGGGACTGAAGAGAAGCTGG + Intergenic
931817502 2:65919323-65919345 AAGAAGGAATAGAGAAAAGTTGG - Intergenic
932441832 2:71742504-71742526 AAGAAGATCTGGAGCAAAGCAGG + Intergenic
932580690 2:72991105-72991127 AGGCAGGGCTGGAGAGCAGCGGG + Intronic
932768837 2:74489322-74489344 AGGAGGGATTGGAGAGCAGCTGG + Intronic
933020626 2:77186334-77186356 AAGAATCACTGGACAGATGCTGG - Intronic
933100983 2:78257106-78257128 AAGAGGGAATGAAGAGAAGCTGG - Intergenic
933303056 2:80564531-80564553 AAGAAGGACTGCCTAGAAGGAGG - Intronic
934311258 2:91867404-91867426 AGGAAGGGTGGGAGAGAAGCGGG + Intergenic
934676102 2:96250712-96250734 AAGAAGGAACGGAGAGAACGTGG + Exonic
935024160 2:99260451-99260473 AAGAGGGAGGGGAGAGAAACTGG - Intronic
935177236 2:100660290-100660312 AAGCAGAAATGGAGAGAAGGAGG + Intergenic
935535281 2:104286243-104286265 AATAAAGACAGGAGAGAAGGGGG + Intergenic
935817416 2:106859753-106859775 AGGAAAGACAGGATAGAAGCAGG - Intronic
936115596 2:109700456-109700478 CAGGAGGACTGGAAGGAAGCGGG + Intergenic
936282202 2:111152030-111152052 AGGAAGAACTGGTGAGAAGTGGG + Intronic
936286045 2:111182167-111182189 AAGAAGGAAGGAAGAGGAGCTGG - Intergenic
936627185 2:114161017-114161039 GAGAAGGAGGGGAGAGAAGAGGG - Intergenic
936931309 2:117792017-117792039 AAGAACGACAGGAAAGAAGGAGG - Intergenic
937300814 2:120840229-120840251 AAGAGAGAATGGACAGAAGCGGG - Intronic
937420202 2:121747820-121747842 GAGAAAGCCAGGAGAGAAGCTGG + Intronic
938018707 2:127888322-127888344 AAGGAGAACTGCAGAGACGCTGG + Intergenic
939212734 2:139197790-139197812 AAGAAGGAGTGTAGGGAAGAGGG + Intergenic
939728215 2:145750232-145750254 CAGTATGACTGGAAAGAAGCTGG - Intergenic
939806121 2:146777514-146777536 ATCAAGGACTGGAAAGATGCAGG + Intergenic
940163611 2:150742465-150742487 AAGAAGGAAGGGAGAAAAGGAGG + Intergenic
940649176 2:156424071-156424093 AACAAGGGCTGGAGAGAACGTGG + Intergenic
941079253 2:161041136-161041158 AAGAATGACTGTAGAGAAATGGG - Intergenic
941600382 2:167536301-167536323 AAGAAGGAAAGGAGAGAGGCAGG + Intergenic
942109351 2:172664764-172664786 AAGAGGCACTGAAGAAAAGCAGG - Intergenic
942121844 2:172785801-172785823 AAGAAGAAGTGGAGAGAAAGGGG - Intronic
942965120 2:181883149-181883171 AAGAAGGAATGAAGAGGAGGAGG + Intergenic
943178882 2:184515993-184516015 TAGAGAGACTAGAGAGAAGCAGG + Intergenic
943660950 2:190558655-190558677 GAGAAGGAGTGAAGAGAAGTAGG + Intergenic
944041916 2:195365459-195365481 AATAAGGACTGAGGAGAAGTGGG - Intergenic
944143037 2:196477701-196477723 AAGGAGGCTTGGAAAGAAGCGGG + Intronic
944351618 2:198734241-198734263 AGGAAGGAGAGGAGTGAAGCAGG + Intergenic
944489018 2:200238323-200238345 GAGAAGGAAGAGAGAGAAGCTGG + Intergenic
944678484 2:202054306-202054328 AAGAAGGAAGGGAGAGATGCAGG + Intergenic
944972511 2:205010138-205010160 GAGAAGGAGTGGAGAGAGTCGGG + Intronic
945544756 2:211137207-211137229 ATGAAGGACTTGAAAGATGCAGG + Intergenic
945680952 2:212913593-212913615 ACGCAGGACTGGAGAAAAACAGG + Intergenic
945884013 2:215355504-215355526 AAGGTGGCCTGGAGAGAAGCAGG - Intergenic
945935061 2:215895504-215895526 AACAAGGAAAGAAGAGAAGCAGG + Intergenic
946891325 2:224280321-224280343 GAGATGGACTGGAGAGGAGTTGG - Intergenic
946970209 2:225082474-225082496 AAGAAGGAAGGGAGAGAAGTGGG + Intergenic
947813139 2:233017164-233017186 AAAAAGAACTGAACAGAAGCAGG + Intergenic
947814038 2:233024000-233024022 AACAAGACATGGAGAGAAGCCGG + Intergenic
948274742 2:236699747-236699769 AACTTGGAGTGGAGAGAAGCAGG + Intergenic
948582639 2:238998287-238998309 ATGAAGGAAGGGAGAGAAGGAGG - Intergenic
948871899 2:240804989-240805011 AAAAAGGAGAGGAGAGAAGAAGG + Intronic
948984426 2:241511511-241511533 AGGTAGGAGTGGAGAGAAGCTGG + Intergenic
1168889823 20:1287798-1287820 AAGGGGGAAGGGAGAGAAGCCGG + Intronic
1169582356 20:7037749-7037771 AAGAATGGCTGGAGATAAGGTGG - Intergenic
1169840068 20:9926158-9926180 AAGAAGTGCTGGTGAGCAGCGGG + Intergenic
1170369451 20:15632822-15632844 AAGAAGGAGAGGAGGGAAGGAGG - Intronic
1170672373 20:18446276-18446298 AAGAAGGAAGGGAGAGAGGGTGG + Intronic
1170897742 20:20431228-20431250 AAGTAGGACTGGAGAGAGGCCGG + Intronic
1171208213 20:23297467-23297489 AAGGCGAACTGGAGAGAGGCTGG + Intergenic
1171368018 20:24639742-24639764 AAACAGGACTGGAAAGAATCAGG - Intronic
1172564516 20:35918480-35918502 CAAAAGGACTCCAGAGAAGCAGG - Intronic
1172590932 20:36117348-36117370 AAGAAGGATTGGAGAAATCCAGG - Intronic
1172823623 20:37761110-37761132 AGGAAGGGCTGCAGAGATGCAGG + Intronic
1173187508 20:40852034-40852056 AAGAAGGACTTGAGAGAGAAAGG + Intergenic
1173557698 20:43978347-43978369 AAGAAGGGCGGGAGGGAGGCAGG - Intronic
1174439456 20:50538289-50538311 GAAAAGGACAGAAGAGAAGCTGG + Intronic
1175182122 20:57156174-57156196 ACGTAGGACTGGAGAGTAGCTGG + Intergenic
1175362232 20:58421704-58421726 AAGAAAGAGAGGAGGGAAGCAGG + Intronic
1175386188 20:58596886-58596908 AGGAAGAATTGGAGGGAAGCGGG + Intergenic
1175744110 20:61441901-61441923 AAGAAGGGTTGGAGAGAACCTGG - Intronic
1176349628 21:5782221-5782243 ACTGAGGTCTGGAGAGAAGCAGG + Intergenic
1176356442 21:5902805-5902827 ACTGAGGTCTGGAGAGAAGCAGG + Intergenic
1176543949 21:8180291-8180313 ACTGAGGTCTGGAGAGAAGCAGG + Intergenic
1176562900 21:8363336-8363358 ACTGAGGTCTGGAGAGAAGCAGG + Intergenic
1176952037 21:15059522-15059544 AAGAAGGAAGGGAGGGAAGGAGG + Intronic
1177003380 21:15640726-15640748 AGGAAGGAAGGGAGAGAAGGAGG - Intergenic
1177273426 21:18877093-18877115 AAGAAGGAATAGAGAGAAAGGGG + Intergenic
1177338270 21:19762135-19762157 AGGAAGGAAGAGAGAGAAGCAGG + Intergenic
1178018389 21:28378871-28378893 AAGTAGGGCTGCAGAGGAGCAGG + Intergenic
1178191962 21:30293312-30293334 AAGAAGGAAAGGAAAGAAGTGGG - Intergenic
1178607887 21:34055371-34055393 AAGAAGGTCTGGACATCAGCAGG + Intergenic
1178634420 21:34289808-34289830 ATGAAGGACTTGAAAGATGCAGG + Intergenic
1179605336 21:42512615-42512637 AAGAAGGTCTGAAGAAAACCTGG + Intronic
1179797500 21:43793929-43793951 AAGGAGGGAAGGAGAGAAGCAGG - Intronic
1180538017 22:16413315-16413337 AGGAAGGGTGGGAGAGAAGCGGG + Intergenic
1182103751 22:27674538-27674560 AAGAAGGAGTGGGGAGAGGGAGG - Intergenic
1182181173 22:28350074-28350096 CATAAGCACTGGAGAGAAACAGG + Intronic
1182193639 22:28491107-28491129 GAGATGGGATGGAGAGAAGCAGG - Intronic
1182253095 22:29017550-29017572 AAGAGGGACCACAGAGAAGCTGG + Intronic
1182675318 22:32034701-32034723 GAGAAGGACTAGAGGGATGCTGG + Intergenic
1182736333 22:32534166-32534188 AGGAAGGAGGGGAGAGAGGCAGG + Intronic
1182950023 22:34365075-34365097 AAGATGGGATGGAGAGAAGGAGG + Intergenic
1182962169 22:34485487-34485509 CAGAAGGAAGAGAGAGAAGCGGG + Intergenic
1183752009 22:39726511-39726533 CAGAAGGACGTCAGAGAAGCAGG - Intergenic
1184003823 22:41694505-41694527 AAGAAGGACAAGAAAGAGGCTGG + Exonic
1184034898 22:41913708-41913730 AGGGAGGAGTGGGGAGAAGCAGG + Intronic
1184630966 22:45779421-45779443 AAGACGGACTGGAAGGAAGAGGG + Intronic
1184854975 22:47141758-47141780 AAGAAGGGAAGGAGAGAAGGAGG + Intronic
1185110257 22:48896572-48896594 TATAAGCACTGGAGAAAAGCAGG + Intergenic
1203248818 22_KI270733v1_random:96513-96535 ACTGAGGTCTGGAGAGAAGCAGG + Intergenic
949250702 3:1980209-1980231 AAGAAGGAAGGGAGAGACGGAGG + Intergenic
949485836 3:4536987-4537009 ATGAAGGACAGGAGTGCAGCAGG + Intronic
949538934 3:5017307-5017329 AAGGTGGACAGGAGAGAAGTTGG + Intergenic
949632950 3:5949001-5949023 ATGAAGCCCTGGAGAGAAGGTGG + Intergenic
950489860 3:13297604-13297626 AAGGAGGAGTGCAGAGAAGTTGG - Intergenic
951336255 3:21425712-21425734 AAGAAGGGAGGGAGAGAAGGAGG + Intronic
951546363 3:23829974-23829996 AAGAAGGAGTGGAGGGAAGGGGG - Intronic
951736784 3:25874931-25874953 AAAAAGGACTGGGTAGAAGTGGG - Intergenic
952078763 3:29731538-29731560 AAGAAGGACTGCAAAGAAGTAGG - Intronic
952948401 3:38496710-38496732 AGGAAGGACATGAGGGAAGCTGG - Intronic
953491249 3:43353863-43353885 AAGAACCACTGGAAAGCAGCAGG - Intronic
953737498 3:45508887-45508909 AAGAAGGAAGGGAGGGAGGCAGG - Intronic
954129651 3:48553909-48553931 AAGAAGGACTGCAGAAAGGACGG - Intronic
954382179 3:50225441-50225463 AAGAAAGACTGGAAAGAAGAAGG + Intergenic
954903918 3:54043677-54043699 AAGAAGGAGGGAAGAGAGGCAGG + Intergenic
955390894 3:58521508-58521530 CAGAAGGCCTGGAGACAAGTGGG - Intronic
955483651 3:59414363-59414385 AAGAAGGAAGAGAGAGAATCTGG - Intergenic
956111106 3:65870619-65870641 GAGAAAGACAGGAGAGAGGCAGG + Intronic
956404349 3:68912319-68912341 AAGAAAGATTGGGGAGAAGGGGG + Intronic
956521110 3:70105348-70105370 AATAATGAGTGGGGAGAAGCTGG + Intergenic
957360117 3:79144457-79144479 AAGAAGGAAAGGAGAGGAGAAGG - Intronic
957400535 3:79707055-79707077 AAGAAAGACTGTAGAGAACTGGG + Intronic
958489796 3:94757791-94757813 CAGCAGGCCTGGAGAGAAGGTGG + Intergenic
958660776 3:97063554-97063576 AAGAAGGGAGGGAGAGAATCAGG + Intronic
958806714 3:98819774-98819796 AAGGAGGACTGGATTGAAGTTGG - Intronic
959348976 3:105236491-105236513 AAGAAGAACTAGAGGAAAGCTGG + Intergenic
959538336 3:107512439-107512461 AAGTATGACTGGAGAGGAGAAGG + Intergenic
960360410 3:116704233-116704255 CAGAAGGACAGGAGAGAAACAGG + Intronic
961328432 3:126125209-126125231 CAGAAGTCCTGGAGAGAAGCAGG - Intronic
961369603 3:126421507-126421529 AAGCAGGGATGGAGAGAAGTGGG + Intronic
961840204 3:129704247-129704269 AGGAATGATTGGAAAGAAGCTGG + Intronic
962472535 3:135724598-135724620 AAGAAATACTGGAGAGAATATGG - Intergenic
962611962 3:137085231-137085253 AAGAAAGAGTAGAGAGAAGCAGG + Intergenic
962685173 3:137840810-137840832 AAGAACCACTGGAAAGAAGCAGG - Intergenic
963776001 3:149441147-149441169 AGGAAGGAAGGGAGAGAAGGAGG + Intergenic
964427788 3:156571367-156571389 AAGTAGCACTGGGGTGAAGCAGG + Intergenic
964836731 3:160947507-160947529 AAGGAGGAATGGGGAGAAGAGGG - Intronic
965907042 3:173721680-173721702 AAGAAGGACTGGAGATAGTAGGG + Intronic
966093626 3:176171630-176171652 AGGAAGGAAAGGAGAGAAGGAGG + Intergenic
966758091 3:183390262-183390284 AAAAAGGAATGGAGATAAGTAGG - Intronic
966944334 3:184767291-184767313 AAGAAAGAATGGAGAGAGGGAGG + Intergenic
967086835 3:186102790-186102812 GAAAATGACTGGAGTGAAGCTGG + Intronic
967197416 3:187040656-187040678 AAGAAGAACTAGAGAAAAGAAGG - Intronic
967278005 3:187795401-187795423 AAGAAGGAAGGGAGGGAAGATGG + Intergenic
968011757 3:195285823-195285845 AAGAATGAATGAAGAGATGCGGG - Exonic
968149373 3:196324949-196324971 AAGAAGGGAAGGAGAGAAGTGGG + Intronic
968844242 4:3031092-3031114 AAGATGGGCTGGAGGGAAGGGGG + Intronic
969207448 4:5657379-5657401 TGGAAGGACTGGAGAGGAGTTGG - Intronic
969211356 4:5689939-5689961 CAGCAGAGCTGGAGAGAAGCTGG - Intronic
969297371 4:6277910-6277932 GAGAAGGACTGCAGAGGAGTGGG - Intronic
969481294 4:7448458-7448480 AAGAAGGAAGGGAGAGAGGGAGG - Intronic
970365044 4:15350064-15350086 AAGAAGGAAGGGAGAGAGGAAGG + Intronic
971290221 4:25330834-25330856 AAGAACCACTGGCCAGAAGCAGG - Intronic
971311565 4:25529913-25529935 AAGAAAGAGAGGAGAGAAGAAGG + Intergenic
971364516 4:25967004-25967026 AAGAATAACTGGAGAAAGGCCGG - Intergenic
971419623 4:26463730-26463752 AAGAAGGACAAGAGAGACCCAGG - Intergenic
972727848 4:41761179-41761201 AGGAAGGAAGGGAGAGAAGGAGG + Intergenic
972766541 4:42156659-42156681 AAGGAGGAGAGGAGAGAGGCGGG + Intergenic
973114157 4:46434434-46434456 AAGAGGGAATGGGGAGACGCAGG - Intronic
973188069 4:47354516-47354538 AGGAAGGCCTGGAGAGCACCCGG - Intronic
973531285 4:51839108-51839130 AAGAAGGGAAGGAGAGAAGGAGG + Intergenic
973744324 4:53948372-53948394 AAGAAGGACAGGAGAGAAGGAGG + Intronic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974522186 4:62996058-62996080 AGGAAGGAAGGGAGAGAAGAAGG + Intergenic
975379356 4:73680404-73680426 AAGGAGGGATGGAGAGATGCAGG + Intergenic
975938131 4:79606814-79606836 AAGTAGCACTGCAGAGAAGATGG - Intergenic
976960525 4:90966158-90966180 AAGAAGGAGTGAAGAGAAAGTGG + Intronic
977206917 4:94173560-94173582 AAGAAGGAAGGGAGAGAGGGAGG + Intergenic
977451659 4:97206750-97206772 AAGAAGGAAGGGAGGGAAGGAGG - Intronic
977605962 4:98985262-98985284 AAGATGGTCTGCAGAGCAGCGGG + Intergenic
977790949 4:101102288-101102310 GAGAGGGAGGGGAGAGAAGCAGG + Intronic
978797239 4:112720401-112720423 AAGTAAGACTGGAGAAAAGATGG - Intergenic
978818975 4:112943344-112943366 AAGAAGGGATGGAGAGAGGCAGG - Intronic
978888119 4:113790373-113790395 AAGAAGGACTAGAAAGAAATGGG - Intergenic
979413989 4:120413648-120413670 ACGGGGGACTGGAGAGAAGGTGG + Intergenic
979769246 4:124502209-124502231 AAGAAGGAATGGAGAAAGGAAGG + Intergenic
980344562 4:131596289-131596311 AAGAAGGAAGGGAGAGAGGGAGG - Intergenic
980802085 4:137765214-137765236 AGGAAGGACTGGAGGGCAGGTGG - Intergenic
981590651 4:146356596-146356618 AAGAAGTAGAGGAGAGAAGATGG - Intronic
982972050 4:162000879-162000901 AAGAAGGGATGGAGGGAAGAGGG + Intronic
982985723 4:162203590-162203612 AAGAAGCACTGGCGGGAACCGGG + Intergenic
983588494 4:169382301-169382323 AAGGAGGAATGAAGAGAGGCTGG + Intergenic
983888346 4:173005642-173005664 AACATGTGCTGGAGAGAAGCAGG + Intronic
984744312 4:183199158-183199180 AAGCAGGACTTGAGGAAAGCAGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985082729 4:186282968-186282990 AAGAATCACTGATGAGAAGCCGG - Intronic
985212694 4:187612218-187612240 AATAAGGAATGAAGAGAGGCAGG + Intergenic
985569602 5:637823-637845 GAGAAGGGCTGGGGAGCAGCAGG + Intronic
985777547 5:1852626-1852648 TAGAAGGACGGGAGGGCAGCAGG - Intergenic
985913457 5:2900552-2900574 AAGCTGGAGTGGGGAGAAGCTGG - Intergenic
986583956 5:9295037-9295059 CAGAAGCACTGGAGAGTAGCAGG - Intronic
986813792 5:11386060-11386082 AACAAGGGCTGGGGAGGAGCTGG + Intronic
986969789 5:13319143-13319165 AAGAGGGATTGGAAAGAGGCTGG - Intergenic
987253924 5:16128543-16128565 AAGAAGGACGGGCAAGAACCAGG + Intronic
987879531 5:23725030-23725052 AGGAAGAAATGGAGAGAAGGGGG - Intergenic
988837137 5:35044647-35044669 ATGAAGGAATGGAGGGAAGGAGG - Intronic
989103235 5:37839312-37839334 AAGTAGAACCGGAGAGAGGCCGG - Intronic
989824707 5:45839193-45839215 AAGCAGGACAGTAGAGGAGCTGG - Intergenic
990002075 5:50906069-50906091 AATAAGCACTTGAAAGAAGCAGG + Intergenic
991142496 5:63260788-63260810 TAGAAGGACTAGAGAAAAGGAGG - Intergenic
991272648 5:64803291-64803313 AAGAAAGAGGGGAGAGAAGAAGG - Intronic
991558471 5:67923041-67923063 AAGAAGGTATGGAGAGAGGGAGG + Intergenic
992864152 5:80940877-80940899 AAAAAGAACTAGAGAGAAGACGG - Intergenic
993033219 5:82728338-82728360 AACAAGGACTGGTGAGAGACTGG - Intergenic
993194222 5:84720353-84720375 AAGAAGGAATCGAGAGACACTGG + Intergenic
993249711 5:85504319-85504341 AAGTAGGTCTAGAGAGATGCAGG + Intergenic
993536784 5:89096149-89096171 ATGAAGGAGTGGGGAGAGGCAGG - Intergenic
993948413 5:94143155-94143177 AAGAGGGAATGAAGAGAAGTTGG - Intergenic
995377600 5:111493646-111493668 AAAAAGGACTTGACAGGAGCAGG - Exonic
995882710 5:116860758-116860780 AAGAAGGAATGAAGGAAAGCAGG - Intergenic
996392314 5:122974724-122974746 ATCAAGGACTTGAGAGATGCAGG - Intronic
996464321 5:123782075-123782097 AAAAAGGAAGAGAGAGAAGCGGG - Intergenic
996585612 5:125084831-125084853 GAGAATGAATGGAGTGAAGCTGG - Intergenic
997110111 5:131065589-131065611 AAGAAGGAAGAGAGAGAAGCAGG - Intergenic
997191601 5:131942026-131942048 AAGAAGGACTGGAAAGAATCAGG - Intronic
997677797 5:135726464-135726486 AAGAAGGAATGGAGGCAAGAGGG - Intergenic
998136266 5:139676209-139676231 AAGAAGGACTGTGGAGGAGGTGG - Intronic
998136277 5:139676245-139676267 AAGAAGGACTGTGGAGGAGGTGG - Intronic
998136307 5:139676321-139676343 GAGAAGGACTGGGGAGGAGGTGG - Intronic
1000203002 5:159030466-159030488 ATGAAGCACTAGAGAGAGGCAGG + Intronic
1000676677 5:164130321-164130343 AAGAAGGAAGGAAGAGAAGAGGG - Intergenic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1002258941 5:177981152-177981174 AACAAGGGGTGGAGAGAAGTGGG + Intergenic
1002270223 5:178066954-178066976 AAGGAGGATGGGAGAGAAGCAGG + Intergenic
1002516086 5:179760043-179760065 AAACAGGACTGGGGAGAGGCTGG + Intronic
1002606379 5:180385292-180385314 GAGACGGAGTGGAGAGAAGGCGG + Intergenic
1002684349 5:180996287-180996309 AAGAAGGGCTGGGGAGGAGGAGG - Intronic
1002867303 6:1132821-1132843 TGGAGGCACTGGAGAGAAGCAGG + Intergenic
1003942115 6:11039900-11039922 AGGAAGGAATGGAGAGAATGTGG + Intronic
1004131236 6:12921761-12921783 AAGAAGGAAGGGAGAGAAACAGG + Intronic
1004258901 6:14090212-14090234 AAGATGGGGTGGAGAGGAGCAGG + Intergenic
1004297336 6:14425124-14425146 AAGAAGGACTGAAGAGCTGATGG - Intergenic
1004367696 6:15025897-15025919 CATAAGGACAAGAGAGAAGCAGG + Intergenic
1004751289 6:18565404-18565426 AAGAAGGAAGGGAGAGAAGGAGG - Intergenic
1005441898 6:25878959-25878981 AGGAAGGAAAGGAGAGAAGGAGG - Intronic
1006341688 6:33450770-33450792 GAGAAGGACTGAAAAGAAGATGG + Intronic
1007174317 6:39885715-39885737 CAGCAGGACTGGAGAGATCCCGG + Intronic
1007259819 6:40555671-40555693 TGGGAGGACAGGAGAGAAGCAGG - Intronic
1007264991 6:40589106-40589128 AAGAAGGAGGGGAGAACAGCAGG + Intergenic
1007410136 6:41656750-41656772 AAAGAAGACTGGAGAGAGGCAGG - Intergenic
1008013025 6:46489236-46489258 AAGAAAGAGTGGAGGGAATCTGG - Intronic
1008522749 6:52378333-52378355 AAGAAGCACAGGACAGAAGTAGG + Intronic
1010938886 6:81892435-81892457 TAGGAGGATTGAAGAGAAGCAGG - Intergenic
1011176609 6:84568363-84568385 AGGAAGGAATGGGGAGATGCTGG + Intergenic
1011371313 6:86639827-86639849 AAGAAGGAGGAGAGAGAAGATGG + Intergenic
1011716411 6:90109671-90109693 GAAAAAGACTGGAAAGAAGCAGG - Intronic
1011957268 6:93038298-93038320 AAGAATCACTGGAAAGAAGTTGG + Intergenic
1013520466 6:110928184-110928206 AAGAAGGAATGAAGGGAAGGAGG - Intergenic
1013641849 6:112091367-112091389 AAGAACCACTGGAAATAAGCGGG + Intronic
1014804857 6:125818059-125818081 AAGAAGGAAGGGGGAGAAGCGGG - Intronic
1014921822 6:127222454-127222476 AGGAAGGAAGGGAGGGAAGCGGG + Intergenic
1015364325 6:132380102-132380124 AAGGAAGACTTGATAGAAGCAGG - Intronic
1015383712 6:132598870-132598892 AAGAAGGATGGGAGAGAGGAAGG + Intergenic
1016011257 6:139139557-139139579 AAGCAGGATTGGGCAGAAGCAGG + Intronic
1016126909 6:140414933-140414955 GAGAAGGACTGGGGAGAAGGAGG - Intergenic
1016183313 6:141173080-141173102 AAGAAGGAATGGGGAGGAGACGG + Intergenic
1016402335 6:143694096-143694118 AAGAAGGAAGGGAGGGAAGAAGG + Intronic
1016534232 6:145092692-145092714 AAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1016990768 6:149926146-149926168 AAGAAGGATTGGAGGGAGGGCGG + Intergenic
1017007499 6:150038283-150038305 AAGAAGGATCGGAGAGAGGGCGG + Intergenic
1017038605 6:150289399-150289421 AAGCAGGACTGGAGAGCTGAGGG + Intergenic
1017359002 6:153543660-153543682 AAGAAAGACTAGAGGGAAGTGGG - Intergenic
1017425083 6:154312317-154312339 GGGAAGGATTGGAGAGAAGTTGG + Intronic
1017663423 6:156695787-156695809 CAGAAGAACAAGAGAGAAGCAGG - Intergenic
1017682933 6:156882284-156882306 AAGAAGCACAGCAGAGAGGCAGG - Intronic
1018037601 6:159894507-159894529 AAGAAGAACTGCAGGAAAGCAGG + Intergenic
1018062630 6:160102658-160102680 AAGAAGGAGAGGAGGTAAGCGGG + Exonic
1018352523 6:162975761-162975783 AAGAAGGGAGGGAGAGAAGAAGG - Intronic
1018475640 6:164138166-164138188 AGGGAGGAATGCAGAGAAGCAGG - Intergenic
1019007495 6:168812532-168812554 AACAAGGACTGGAGAACAGGAGG - Intergenic
1019598025 7:1867353-1867375 AAGATGTAGAGGAGAGAAGCGGG + Intronic
1020786067 7:12573896-12573918 ACGAAGGACTGGCTAGAAACTGG + Intronic
1021196010 7:17674955-17674977 AAGAAGCACAGGAGACAAGAAGG - Intergenic
1021329493 7:19318103-19318125 AAGAAGGAGAGGTGAGAAACTGG + Intergenic
1021656902 7:22881706-22881728 AAGAAAGACTGGAGGGAAGAGGG - Intergenic
1022471253 7:30682942-30682964 GAGGAGGCCTGGAGGGAAGCAGG + Intronic
1022537931 7:31109528-31109550 AAGTGGGGCTGGGGAGAAGCAGG + Exonic
1022633400 7:32107341-32107363 AAGAAGGAAGGGAGAGAAGGAGG + Intronic
1022737544 7:33090105-33090127 AGAAAGGACTGGAGAGGATCTGG + Intergenic
1022804434 7:33807577-33807599 AAGAACGAATGGTGAGAAGCAGG - Intergenic
1023397376 7:39763779-39763801 AAGGAGGAAGGGAGAGAAGGAGG - Intergenic
1023460809 7:40394662-40394684 AGGAAGCACTGGGGAGATGCTGG - Intronic
1023496369 7:40801543-40801565 AAGAAGGGGTTGGGAGAAGCTGG + Intronic
1024248267 7:47487000-47487022 AGTAAGGACTGAAGAGAGGCCGG + Intronic
1025299359 7:57805781-57805803 AAGAGGGACAGGAGAGCACCAGG - Intergenic
1026639986 7:72115813-72115835 AGGAAGGAGGGGAGAGAAGGTGG - Intronic
1027239476 7:76317992-76318014 AAGACGGAGGAGAGAGAAGCGGG + Intergenic
1028061239 7:86319324-86319346 AAGAAGGAGGGGAGAGAGACAGG + Intergenic
1028822347 7:95227118-95227140 AATAAGGGCTGCAGAGAAACAGG - Intronic
1028849074 7:95515966-95515988 AGGCAGGACTGGAGTGAAACAGG - Intronic
1029164052 7:98573583-98573605 AGGAAGGAAGGGAGGGAAGCAGG + Intergenic
1029234144 7:99099264-99099286 GAGAAGGAATGGAGAGAGGCAGG + Intronic
1029359191 7:100075882-100075904 AAGAGTGACTGGAGAGAAGAGGG - Intronic
1029372575 7:100158697-100158719 CCGAATGACTGGAGAGAAACAGG + Intronic
1030424445 7:109356301-109356323 AAGGAGGAAGGGAGAGAAGGAGG + Intergenic
1030650898 7:112115008-112115030 TAGATAGACTGGAGAGAGGCAGG - Intronic
1030762132 7:113364972-113364994 AAGGAGGAAGAGAGAGAAGCGGG - Intergenic
1031711896 7:125058172-125058194 AACAAGGACTTGAGAGCAGCTGG - Intergenic
1032444552 7:131970833-131970855 AGGAAGTGCTGGAGAGAGGCTGG - Intergenic
1032530862 7:132618543-132618565 AGGCAGAACTGGAGGGAAGCAGG - Intronic
1032785902 7:135199113-135199135 TAGAAGAACTGGAAAGCAGCAGG - Intronic
1032996113 7:137448552-137448574 AAGAAGGGAGGGAGAGAAGGAGG + Intronic
1033169860 7:139073948-139073970 AAGAAGGAGTGGAGAGGCGTCGG + Exonic
1033534321 7:142298324-142298346 CAGAGGGACTGCAGAGATGCAGG - Intergenic
1033609849 7:142954536-142954558 AAGAGAGACTGGAGAGAAGCAGG + Intronic
1033610832 7:142961889-142961911 GAGAAGGAGGAGAGAGAAGCTGG + Intronic
1034237665 7:149585288-149585310 ACCAAGGACTGGGGAAAAGCAGG + Intergenic
1034240746 7:149608947-149608969 ACCAAGGACTGGGGAAAAGCAGG + Intergenic
1034738278 7:153449272-153449294 GACAAGGGCTGGAGGGAAGCAGG + Intergenic
1034889727 7:154829387-154829409 AAAAAGGAAAGGAGAGAAGAGGG + Intronic
1034905671 7:154943408-154943430 AACAGGGTCTGGAAAGAAGCAGG + Intronic
1034927925 7:155138206-155138228 AAGCAGGACTGGGCAGAAGGAGG + Intergenic
1035573150 8:687586-687608 GAGCAGGACTGGAGGGAGGCGGG + Intronic
1035578704 8:725847-725869 ACGAAGGAGGGGAGAGAAGAAGG - Intronic
1036546120 8:9771456-9771478 AAGAAGGGAGGGAGAGAAGAAGG + Intronic
1036616195 8:10389667-10389689 AGGCAGGACTGGAGAGAGGATGG - Intronic
1037009742 8:13826071-13826093 ACGAAGGACTGGAGAGTGCCAGG + Intergenic
1037736254 8:21569369-21569391 ATGAAGGACTCAGGAGAAGCAGG - Intergenic
1037752835 8:21693759-21693781 AAGAAGGAGAGGAGAGAGGAAGG + Intronic
1037774427 8:21823494-21823516 AAGAAGGGAAGGAGAGAAGGAGG - Intergenic
1038486396 8:27938034-27938056 AAGATGAACTGGAAAGAAGTTGG + Intronic
1038547139 8:28434434-28434456 AAGAAGGACTGGCACAAAGCAGG - Intronic
1039617758 8:38969815-38969837 AGGGAGGACTTGAGAGAAGGAGG + Exonic
1039721188 8:40166155-40166177 AAGAAGTATTGAAGAGAAGGTGG + Intergenic
1039764422 8:40613105-40613127 GAGAATGACTGGATAGAGGCCGG - Intronic
1040049316 8:42996564-42996586 AAGAAAGGCCGGAGAGAAACTGG - Intronic
1040063448 8:43124530-43124552 AAGGAGGACTGGAGAGACAATGG + Intergenic
1040903569 8:52441698-52441720 AGGAAGGAAGGGAGAGAAGGAGG + Intronic
1041837314 8:62231006-62231028 AATAGGGACTGGTGAGAGGCAGG - Intergenic
1041935128 8:63324895-63324917 AAGCAGGTCTGGGGGGAAGCTGG - Intergenic
1043161929 8:76856226-76856248 GAGAAGGACTGGAGGAAGGCCGG - Exonic
1044288489 8:90439130-90439152 AATAATGACAGAAGAGAAGCTGG - Intergenic
1044397521 8:91730571-91730593 AAGAAGGACAGGAAAGCAGATGG + Intergenic
1044891752 8:96843330-96843352 AAGGAGGAAGGGAGGGAAGCAGG + Intronic
1045409543 8:101903549-101903571 AATGAGGACTGTAGAGAAGTTGG + Intronic
1045554931 8:103206770-103206792 AAGGAGGGAGGGAGAGAAGCAGG + Intronic
1045743445 8:105388304-105388326 AAGAAGAAATGGAGAGAAAAGGG + Intronic
1045875709 8:106978501-106978523 AAGATGGACGGGAGTGAAGGAGG + Intergenic
1046360849 8:113153173-113153195 AAGAAGGAAGGGAGGGAAGGAGG + Intronic
1046750577 8:117922610-117922632 AAGGAGAACAAGAGAGAAGCTGG + Intronic
1047208203 8:122820159-122820181 GACAGGGACTGGAGAGCAGCCGG - Intronic
1047648642 8:126896052-126896074 AAGAATGAGGGGAGAGATGCTGG - Intergenic
1047789059 8:128183845-128183867 AAGAAGGAAGGGAGAGAGGGAGG - Intergenic
1047927633 8:129696981-129697003 AAGAAGGATTGGAGGGAGGTGGG + Intergenic
1048287208 8:133151246-133151268 AAAAAGGACTGGAGAGAGTCTGG - Intergenic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1048742556 8:137578237-137578259 AAGGAGGAATGGAGGGAAGGAGG - Intergenic
1048754509 8:137722061-137722083 AAGAAGGAAGGAAGAGAAGGTGG + Intergenic
1049148489 8:141019440-141019462 CAGAAGGAGGGGAGAAAAGCTGG - Intergenic
1049190467 8:141284768-141284790 AAGAAGGACTGAAGGGCAGGAGG + Intronic
1049361051 8:142212788-142212810 GGGAAGGATTGGAGAGAAGGAGG - Intronic
1049361076 8:142212859-142212881 AGGAAGGATTGGAGAAAGGCGGG - Intronic
1049361164 8:142213115-142213137 AGGAAGGATTGGAGAGAAGGTGG - Intronic
1049945067 9:586456-586478 AAGAAGGGGTAGAGAGCAGCTGG + Intronic
1050308553 9:4330200-4330222 TAGAAGGAAAGGAAAGAAGCAGG + Intronic
1050884673 9:10749318-10749340 AAGAAAAACTGGAGTGGAGCGGG - Intergenic
1051352411 9:16210217-16210239 AAGAAGGAAGGGAGAGAGGAAGG + Intronic
1051799412 9:20915054-20915076 AAGGAAGACTAGAGAAAAGCAGG + Intronic
1051823063 9:21191302-21191324 AAGAATGCCTTGAGAGAACCTGG - Intergenic
1051824891 9:21209837-21209859 AAGAATGCCTTGAGAGAACCTGG - Intronic
1051826886 9:21231911-21231933 AAGAATGCCTTGAGAGAACCTGG - Intronic
1051873171 9:21762697-21762719 AGGGAGGACTGGAGGGAATCAGG + Intergenic
1052077277 9:24158796-24158818 AAGAAGGAAAGGAGAGCAGGAGG - Intergenic
1053054736 9:34987880-34987902 AAGAAGGGCTGGGGAGGGGCAGG - Intergenic
1053203298 9:36166891-36166913 GAAAAGGACTGGAGAGTAGTGGG - Intergenic
1053332337 9:37224864-37224886 AAGAATAACTGGAAAGGAGCAGG + Intronic
1053589596 9:39498529-39498551 AAGGAGAACTGGGGAGGAGCAGG - Intergenic
1054453995 9:65420305-65420327 TGGAAGGACAGGAGAGAAGAAGG + Intergenic
1054576701 9:66866757-66866779 AAGGAGAACTGGGGAGGAGCAGG + Intronic
1054952757 9:70871396-70871418 AAGTAAGACTGGAGAGAATCGGG - Intronic
1055107174 9:72525274-72525296 AAGTAGGACAGGAGGGCAGCTGG + Intronic
1055566469 9:77573864-77573886 AAGAGGGTCAGGAGAGAAGGTGG + Intronic
1056375610 9:86007516-86007538 AAGAAGGAGTACAGAGAAGTTGG - Intronic
1056655131 9:88502840-88502862 AAGATGGACAGGAGGGCAGCGGG + Intergenic
1057143540 9:92743118-92743140 AAGAAGTCCTGGAGAGGAGTGGG - Intronic
1057496281 9:95563910-95563932 AGGAAGGAAGGGAGAGAAGAAGG - Intergenic
1057616961 9:96600332-96600354 AAGAAGAACTGGACAGATGAGGG + Intronic
1057756380 9:97840765-97840787 AACAAGTACTGGAGAGGATCTGG + Intergenic
1058799558 9:108531625-108531647 AAGAAGGAAGTGAGAGAAGGAGG + Intergenic
1059154348 9:111976678-111976700 AGGAAGGAATGGAGAGAAGGAGG + Intergenic
1059284314 9:113159765-113159787 CAGAAGTACGGGAGACAAGCTGG - Intronic
1059347828 9:113643542-113643564 AAGAAGGCAGGGAGAGAAGAAGG - Intergenic
1059379299 9:113910695-113910717 AGGAAGGACAGGAGAGAGGATGG - Intronic
1059739955 9:117140535-117140557 AAGAAGGGATGAAGAGAAGGAGG + Intronic
1059780026 9:117516421-117516443 AGGAAGGACTGGAGTGAAGTGGG + Intergenic
1060126563 9:121053436-121053458 AAGACTGACTGGAGAGAGGGCGG + Intergenic
1060531146 9:124347640-124347662 CAGAAGGACTAGAGAGGAGGAGG - Intronic
1061009531 9:127946749-127946771 AAAAGGGAGTGGAGGGAAGCTGG + Intronic
1061271542 9:129546575-129546597 AAGAAGGAGTGGAGAAAGGTGGG - Intergenic
1061312141 9:129770723-129770745 ATTAAGGACTGGAAAGATGCAGG - Intergenic
1061864246 9:133484464-133484486 GAGAAGGACAGGAGAGAGGAAGG - Intergenic
1062050990 9:134446951-134446973 AAGCAGGGCTGGAGAGAGACGGG + Intergenic
1062252407 9:135604948-135604970 AAGGAGGAAAGGAGGGAAGCAGG + Intergenic
1062478796 9:136742188-136742210 GAGCAGGGCTGCAGAGAAGCAGG + Intronic
1062586543 9:137252277-137252299 AAGGAGGCCTGGAGAGAGGAGGG + Intronic
1062586732 9:137252968-137252990 AAGGAGGCCTGGAGAGAAGAGGG + Intronic
1203465218 Un_GL000220v1:79761-79783 ACTGAGGTCTGGAGAGAAGCAGG + Intergenic
1185525263 X:773534-773556 AAGAAGGAAGGGAGAGAGGAAGG + Intergenic
1185534838 X:852853-852875 AAGAAGGGATGGAGAGAGGTTGG - Intergenic
1185661797 X:1734289-1734311 AAGTAGAATTGAAGAGAAGCGGG + Intergenic
1185776632 X:2808557-2808579 AAGAAGGACAGGAGAAAGGAAGG + Intronic
1185882674 X:3755396-3755418 AAGAAGGAAGGGAGGGAAGGGGG - Intergenic
1186246596 X:7622406-7622428 AGGAAGGAAGGGAGAGAAGGAGG - Intergenic
1186269189 X:7866473-7866495 AAGAAGGAAGGGAGAGAGGAAGG - Intergenic
1186792748 X:13014989-13015011 AACAAGGAAAGGAGAGAAGAAGG - Intergenic
1187126317 X:16457621-16457643 AAGAAGGAAGGGAGAGAGGGAGG + Intergenic
1187871284 X:23767088-23767110 GAGAAGCACAGGAGAGAGGCTGG - Intergenic
1188177579 X:27010967-27010989 AAGGGGGACTGGAGAGAAGGGGG - Intergenic
1189098447 X:38164050-38164072 AAGAAGGGGTGGTGAGAAGAAGG - Intronic
1189222249 X:39382491-39382513 AAGATGGCCTGGAGGGAAGGGGG - Intergenic
1189330705 X:40143124-40143146 CAGAAGGACTGGCGAGCTGCAGG + Intronic
1190196243 X:48321213-48321235 TAGAAAGACTGTAGAGAAGGCGG - Intergenic
1190662956 X:52671579-52671601 TAGAAAGACTGTAGAGAAGGCGG - Intronic
1190676467 X:52786903-52786925 TAGAAAGACTGTAGAGAAGGCGG + Intronic
1191225606 X:58040052-58040074 AAGAAGAAATGGAGAAAACCTGG + Intergenic
1191786650 X:64923522-64923544 AAGAGAGACTGAAGACAAGCAGG - Intronic
1192158877 X:68768160-68768182 AAGAAGGAGGGAAGAGAAGGAGG - Intergenic
1192341139 X:70264336-70264358 ACGAAGGAAGGGAGAGAAGGAGG + Intergenic
1192544118 X:71998583-71998605 GTGAAGGGCTGGAGAGAAGGGGG + Intergenic
1192567254 X:72175270-72175292 AAAAAGGACTTCAGAGAAGAAGG - Intergenic
1194305827 X:92246872-92246894 AAGGAGGAATGGAGAGAAAGAGG + Intronic
1194319541 X:92427035-92427057 AAGAAGGAAAGGAGAAAGGCAGG - Intronic
1194809610 X:98374695-98374717 AAAAAGGACTATACAGAAGCAGG + Intergenic
1194923803 X:99798994-99799016 AAGATGAACTGGAGAGACTCAGG - Intergenic
1195077149 X:101338096-101338118 AAGCAGAAATGGAGAGAAGGAGG - Intergenic
1196418247 X:115496048-115496070 TAGAGGGACTGGAGAGGGGCTGG + Intergenic
1196516436 X:116617942-116617964 AAGCCAGACTGGAGAGAAGGAGG + Intergenic
1197316031 X:124966935-124966957 AAGAGGGGCTGGAGAGAACGTGG + Intergenic
1197597401 X:128482112-128482134 AAAAAGGACTTGAGGGAATCTGG - Intergenic
1199211849 X:145221605-145221627 AAGCAGGACAGGAGAAAAGCAGG + Intergenic
1199316543 X:146385336-146385358 AAGTAGGAATAGAGAGAAGATGG + Intergenic
1199430352 X:147752805-147752827 GAGAAGGAGGGAAGAGAAGCAGG - Intergenic
1199595722 X:149504650-149504672 AAGAAAGGATGGAGAGAAGGAGG + Intronic
1200006424 X:153088237-153088259 AAGAATGAAGGGAGAGAAGTGGG - Intergenic
1200293639 X:154895253-154895275 AAGAAGCAGGGTAGAGAAGCAGG + Intronic
1200334362 X:155334054-155334076 AAAAAAGTCTGGAGAGAAGGAGG + Intronic
1200526373 Y:4279086-4279108 ATCAAGGACTTGAGAGATGCAGG - Intergenic
1200627665 Y:5540111-5540133 AAGAAGGAAAGGAGAAAGGCAGG - Intronic
1200782322 Y:7227918-7227940 AAGAAGGAAGGGAGGGAAGGGGG + Intergenic
1201267140 Y:12218278-12218300 AAGAAGGAAGGGAGAGAGGAAGG - Intergenic
1201517703 Y:14835676-14835698 AAGAAGGAAGGGAGAGAGGAAGG + Intronic
1201550256 Y:15211150-15211172 AAGAAGGAAGGGAGAGAGGGAGG + Intergenic