ID: 1160522879

View in Genome Browser
Species Human (GRCh38)
Location 18:79518845-79518867
Sequence GCGGCCAGTGCCCACGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 169}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160522867_1160522879 26 Left 1160522867 18:79518796-79518818 CCCTGGCACCCGGTGTCCCTCAG 0: 1
1: 0
2: 0
3: 18
4: 196
Right 1160522879 18:79518845-79518867 GCGGCCAGTGCCCACGGTGCAGG 0: 1
1: 0
2: 3
3: 13
4: 169
1160522876_1160522879 -4 Left 1160522876 18:79518826-79518848 CCGTTGATTCTGTAACAAGGCGG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1160522879 18:79518845-79518867 GCGGCCAGTGCCCACGGTGCAGG 0: 1
1: 0
2: 3
3: 13
4: 169
1160522873_1160522879 10 Left 1160522873 18:79518812-79518834 CCCTCAGTGGACGGCCGTTGATT 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1160522879 18:79518845-79518867 GCGGCCAGTGCCCACGGTGCAGG 0: 1
1: 0
2: 3
3: 13
4: 169
1160522866_1160522879 27 Left 1160522866 18:79518795-79518817 CCCCTGGCACCCGGTGTCCCTCA 0: 1
1: 0
2: 0
3: 7
4: 160
Right 1160522879 18:79518845-79518867 GCGGCCAGTGCCCACGGTGCAGG 0: 1
1: 0
2: 3
3: 13
4: 169
1160522871_1160522879 18 Left 1160522871 18:79518804-79518826 CCCGGTGTCCCTCAGTGGACGGC 0: 1
1: 0
2: 1
3: 14
4: 119
Right 1160522879 18:79518845-79518867 GCGGCCAGTGCCCACGGTGCAGG 0: 1
1: 0
2: 3
3: 13
4: 169
1160522868_1160522879 25 Left 1160522868 18:79518797-79518819 CCTGGCACCCGGTGTCCCTCAGT 0: 1
1: 0
2: 0
3: 12
4: 165
Right 1160522879 18:79518845-79518867 GCGGCCAGTGCCCACGGTGCAGG 0: 1
1: 0
2: 3
3: 13
4: 169
1160522874_1160522879 9 Left 1160522874 18:79518813-79518835 CCTCAGTGGACGGCCGTTGATTC 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1160522879 18:79518845-79518867 GCGGCCAGTGCCCACGGTGCAGG 0: 1
1: 0
2: 3
3: 13
4: 169
1160522872_1160522879 17 Left 1160522872 18:79518805-79518827 CCGGTGTCCCTCAGTGGACGGCC 0: 1
1: 0
2: 1
3: 11
4: 103
Right 1160522879 18:79518845-79518867 GCGGCCAGTGCCCACGGTGCAGG 0: 1
1: 0
2: 3
3: 13
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160522879 Original CRISPR GCGGCCAGTGCCCACGGTGC AGG Intronic
900123232 1:1058491-1058513 GCGGCCAGAGGCCAGCGTGCAGG + Intergenic
900285761 1:1899608-1899630 GCGGACAGAGCCCACGGGGGTGG + Intergenic
900354276 1:2252562-2252584 GCAGTCAGTGCCCGCGGAGCAGG + Intronic
900603917 1:3515496-3515518 GCCGCCATTGCCCAGGGCGCAGG + Exonic
901807716 1:11748704-11748726 GGGGCCAGGGCTCAAGGTGCAGG + Intronic
901921495 1:12540614-12540636 GAGGCCAGAGCCCAGTGTGCGGG + Intergenic
902180945 1:14687943-14687965 GTGCCCAGTGCCCACGGCACAGG + Intronic
902368269 1:15990963-15990985 GGGGCCAGTTCCCACAGAGCAGG + Intergenic
902374927 1:16026204-16026226 GCTGCCGGTGGCCAGGGTGCAGG - Exonic
904612873 1:31735107-31735129 GGGGGCAGTGCCCATGGTGGGGG - Intronic
905414392 1:37794406-37794428 GCCGCCAGGGTCCGCGGTGCGGG - Exonic
905734696 1:40317080-40317102 GCTGCCAGGGTCCAGGGTGCGGG - Intronic
906247269 1:44285068-44285090 GAGCCCAGTGTCCATGGTGCTGG - Intronic
907159570 1:52360464-52360486 GCGGCCAGTGCCAAGGAGGCAGG - Exonic
907341441 1:53738768-53738790 GTGGGCATTGCCCACTGTGCCGG - Intergenic
908170971 1:61504389-61504411 GCGGCCAGTGGCAACTGTACTGG + Intergenic
915341435 1:155178860-155178882 GCGGGCAGGGCCCCCGGGGCAGG - Intronic
918229613 1:182515754-182515776 GCACCCAATGGCCACGGTGCGGG - Intronic
919930225 1:202216574-202216596 GCGGCTAGTGGCCACTGCGCTGG + Intronic
920363646 1:205436482-205436504 GTGGTCAGTGCCCACTGTGCCGG - Intronic
922677082 1:227559789-227559811 GGGCCCAGGGCCCACGGTCCTGG - Intergenic
922677273 1:227560734-227560756 GGGCCCAGGGCCCACGGTCCTGG - Intergenic
922722456 1:227905851-227905873 GCAGGCAGTGCCCACCATGCTGG - Intergenic
922892684 1:229073714-229073736 GAGCCCTGAGCCCACGGTGCTGG - Intergenic
1069546910 10:69335240-69335262 GCGGGCACAGACCACGGTGCGGG + Intronic
1077273774 11:1693938-1693960 GCGGGCAGAGCCCTCGGTGTGGG - Intergenic
1077525289 11:3060561-3060583 GCCACCAGTGGCCACCGTGCAGG + Intergenic
1079005612 11:16789537-16789559 GAGGCCAGAACCCAGGGTGCAGG + Intronic
1079388308 11:19999978-20000000 CAGGCCAGTGGCCACGGTGCTGG - Intronic
1080006234 11:27410144-27410166 GTGGCTAGTGGCTACGGTGCTGG + Intronic
1080764254 11:35280951-35280973 GCGGCCAGTATCCCCAGTGCCGG - Exonic
1081753801 11:45530772-45530794 ACAGCCAGAGCCCAGGGTGCTGG + Intergenic
1082838330 11:57668007-57668029 GCGGCCGTTGCCCTCAGTGCCGG - Exonic
1083876181 11:65525392-65525414 GCGGGCAGTGCCTACGTGGCGGG + Intronic
1084182206 11:67452430-67452452 GCGGCCAGTGTCCCCCATGCCGG + Exonic
1084419436 11:69053008-69053030 GTGGCCCGTGCCTACGATGCGGG + Intronic
1085691799 11:78670321-78670343 GCGGCCAGTGCCCAGGTAGAAGG + Exonic
1089735367 11:120547034-120547056 GCTGCCAGAGCCCAAGGGGCAGG - Intronic
1090905534 11:131071295-131071317 GCTGCCAGTCCACATGGTGCTGG - Intergenic
1090985262 11:131760849-131760871 GAGGACTGTGCCCACGATGCTGG + Intronic
1092289549 12:7150993-7151015 GGGGCTGGTGACCACGGTGCAGG - Exonic
1096078516 12:48818972-48818994 GCGGTGAGTGCCCACGATGAGGG + Exonic
1096604427 12:52754499-52754521 GAAGCCAGTGCCCAGGGTGCTGG - Intergenic
1096862580 12:54540439-54540461 GAGGGCAGTGCCCATGGTGGTGG + Intronic
1103948376 12:124539381-124539403 GCGGGGAGGGCCCACGGAGCCGG - Intronic
1104734750 12:131129914-131129936 GCGGCCCATGCCCTCGGGGCAGG - Intronic
1104828319 12:131730750-131730772 GCCGTCAGTGCCCAGGGTGGTGG - Intronic
1105927686 13:25021937-25021959 ACGGCCAGTGCCCACGGTGAGGG - Intergenic
1113378279 13:109783484-109783506 GCGGCCAGCGCCTTCGGGGCCGG - Exonic
1117803195 14:59465258-59465280 GCGGCCGCCGCCCCCGGTGCGGG - Exonic
1118392118 14:65304330-65304352 GCGGCCTGTGCATAGGGTGCTGG + Intergenic
1121721359 14:96111012-96111034 GGAGCCAGTGCCCATGATGCAGG - Intergenic
1122143094 14:99674028-99674050 GGGGCCAGGGGCCAGGGTGCAGG + Intronic
1122422538 14:101586722-101586744 GCAGCCAGTGCCCACAGTAGGGG + Intergenic
1122822253 14:104353500-104353522 GCGGCCAGTCACCACAGTGGGGG - Intergenic
1122880447 14:104688454-104688476 GCGGCCAGGGCTCAGGGTGAGGG - Intergenic
1123696440 15:22882235-22882257 GCTGGCAGTGCTCACGATGCTGG - Intronic
1124963824 15:34418760-34418782 ACGGCCTGTGCCCATGGTTCAGG + Intronic
1125329037 15:38564633-38564655 GCGGCCCGCGCTCCCGGTGCCGG + Exonic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1132549752 16:549481-549503 GCCGCCCGTGCCCACCCTGCAGG - Intronic
1132584613 16:700785-700807 GCGGCCGCTGTCCATGGTGCTGG - Intronic
1133858849 16:9575150-9575172 GCAGCCAGTAACCACGCTGCTGG + Intergenic
1134111095 16:11516009-11516031 GTAGCCAGTCCCCATGGTGCTGG + Exonic
1136716352 16:32286683-32286705 GCGGCCAGTGGGCATTGTGCTGG + Intergenic
1136834738 16:33492961-33492983 GCGGCCAGTGGGCATTGTGCTGG + Intergenic
1138131647 16:54484878-54484900 CCGGCCAGTCCCCACACTGCTGG - Intergenic
1139464655 16:67147933-67147955 GGGGCCAGTGCCCAGGGTTGGGG - Exonic
1141869952 16:86778569-86778591 GTGGCCAGTGCCCACTGGGCTGG - Intergenic
1142210146 16:88804831-88804853 AAGGCCAGTGCCCAGGATGCTGG + Exonic
1203010065 16_KI270728v1_random:231071-231093 GCGGCCAGTGGGCATTGTGCTGG - Intergenic
1203144908 16_KI270728v1_random:1793249-1793271 GCGGCCAGTGGGCATTGTGCTGG + Intergenic
1142632058 17:1231479-1231501 ACGGCCTGTGCCCATGGTTCAGG - Intergenic
1143118462 17:4593425-4593447 GGGGACAGTGCCCAACGTGCAGG - Intronic
1143773609 17:9183496-9183518 TCCGCCAGTGACCACGGTGCAGG - Intronic
1144943702 17:18959154-18959176 GAGGCCAGAGCCCTCGCTGCTGG - Exonic
1146208040 17:30921877-30921899 GCGGACAGTCCTGACGGTGCGGG + Exonic
1146844929 17:36176420-36176442 GGGGACAGTGGCTACGGTGCGGG - Intronic
1146857235 17:36264355-36264377 GGGGGCAGTGGCTACGGTGCGGG - Intronic
1146863380 17:36324020-36324042 GGGGGCAGTGGCTACGGTGCGGG + Intronic
1146873147 17:36388265-36388287 GGGGGCAGTGGCTACGGTGCGGG - Intronic
1146880505 17:36439351-36439373 GGGGACAGTGGCTACGGTGCGGG - Intronic
1146978847 17:37140878-37140900 GATGCCAGTGCCCCGGGTGCAGG + Intronic
1147066240 17:37924608-37924630 GGGGGCAGTGGCTACGGTGCGGG + Intronic
1147076030 17:37988890-37988912 GGGGGCAGTGGCTACGGTGCGGG - Intronic
1147077773 17:38004169-38004191 GGGGGCAGTGGCTACGGTGCGGG + Intronic
1147087555 17:38068436-38068458 GGGGGCAGTGGCTACGGTGCGGG - Intronic
1147093710 17:38128104-38128126 GGGGGCAGTGGCTACGGTGCGGG + Intergenic
1147103497 17:38192385-38192407 GGGGGCAGTGGCTACGGTGCGGG - Intergenic
1147720467 17:42536605-42536627 GCGGCCACTGCCAGCCGTGCCGG + Exonic
1150086427 17:62275485-62275507 GGGGACAGTGGCCACGGTGCGGG - Intronic
1151716233 17:75832527-75832549 GTGGTCCCTGCCCACGGTGCAGG - Intronic
1152096921 17:78277953-78277975 CCGGCCGGTGCTCACGGGGCTGG + Intergenic
1152248697 17:79200271-79200293 GTGGCCTGTGCCCAAGCTGCTGG + Intronic
1152854801 17:82658635-82658657 GCGGCAGGTGCCCACGGAGCAGG - Exonic
1152896228 17:82913033-82913055 GCCTCCAGAGCACACGGTGCAGG + Intronic
1152911995 17:83010238-83010260 GCGGCCGAAGCCCCCGGTGCTGG - Intronic
1155987284 18:32243572-32243594 GGGGCCAGTGCCCACAGATCTGG + Intronic
1156483067 18:37448295-37448317 GGGGCCAGGGCCCTGGGTGCTGG + Intronic
1159023184 18:63159840-63159862 GTGGGCAGTCCCCACTGTGCGGG - Intronic
1160522879 18:79518845-79518867 GCGGCCAGTGCCCACGGTGCAGG + Intronic
1161062069 19:2220171-2220193 GGTGCTAATGCCCACGGTGCTGG + Exonic
1162760396 19:12885486-12885508 GAGTCCAGTGCCCACCGTCCCGG + Exonic
1167049533 19:47069939-47069961 GGTGCCAGTGCCCACGCTGCAGG - Intronic
1167721418 19:51182749-51182771 GAGGCAACTGCCCAGGGTGCAGG + Intergenic
1167729232 19:51241125-51241147 GAGGCAACTGCCCAGGGTGCAGG + Intronic
1167763558 19:51464021-51464043 GAGGCAACTGCCCAGGGTGCAGG - Intergenic
932625093 2:73291260-73291282 GCGGACAGTTCCCGCGGTCCAGG - Exonic
934953107 2:98592785-98592807 GGGGCCGATGTCCACGGTGCTGG - Intronic
935664071 2:105494882-105494904 GGGGCCTGTGCCCACGGACCTGG - Intergenic
936451693 2:112638549-112638571 CCTGCCAGGGCCCACCGTGCAGG + Intergenic
937083930 2:119158413-119158435 GCGGCCAGGACCCGCGGAGCCGG - Exonic
942184976 2:173416299-173416321 GCGGCCCGTGCACACGGGGCCGG + Intergenic
946176156 2:217922988-217923010 GTGGCCAGGGGCCAGGGTGCCGG - Intronic
946405302 2:219489146-219489168 GTGGCCTGTGCCAACCGTGCTGG + Exonic
946622383 2:221573358-221573380 GGTGCCAGTGCCCCCGGGGCCGG - Intronic
948662273 2:239514959-239514981 GCGGCGGGTGGCCACGGGGCGGG - Intergenic
1170778567 20:19402893-19402915 GTGGCCAGTGGCCACTGTCCTGG - Intronic
1176111728 20:63413998-63414020 GCTGCCGGTGCTCATGGTGCTGG - Intronic
1176131024 20:63496917-63496939 GAGGCCAGGGCCCAAGGTGGGGG - Intronic
1176145727 20:63564597-63564619 GGAGCCAGTGCCCATGCTGCCGG - Exonic
1179541243 21:42084367-42084389 GCTGCCTGTGCACACGGTGGGGG - Intronic
1180143793 21:45908811-45908833 GCGGCCTGTGCCCACCCTCCTGG - Intronic
1180225306 21:46388613-46388635 GCTGCCTGTCCCCACGGGGCCGG - Intronic
1181083761 22:20429905-20429927 GCGGCCAGGGCCCAGGGTCCAGG + Intronic
1181340924 22:22179225-22179247 GCAGCCACTGCTCAGGGTGCAGG - Intergenic
1181580830 22:23827253-23827275 GCTGCCAGTGCCCACAGTCCAGG + Intronic
1181750041 22:24982878-24982900 GAGGCCAGTGGCCTGGGTGCTGG + Intronic
1182504225 22:30770636-30770658 GGGGCCTGTGCTCAGGGTGCAGG + Intronic
1183030912 22:35103922-35103944 GCGGTCAGGGCCCAGGCTGCTGG - Intergenic
1185267180 22:49910446-49910468 GCGGACACTGCCCAATGTGCTGG - Exonic
1185348024 22:50319119-50319141 CAGGTCAGTGCCCAAGGTGCTGG + Intronic
950014413 3:9745671-9745693 GCGGCCAGTGCCCACGGAGTAGG - Exonic
950441068 3:13010780-13010802 GGGCCCAGAGCCCAGGGTGCTGG - Intronic
950590455 3:13932974-13932996 GCGGCCAGAGCGCAGGGTTCCGG + Intergenic
954205696 3:49057392-49057414 GCAGCCGGTGGCCACCGTGCTGG - Exonic
954219353 3:49143569-49143591 GCTGGCAGTGCCCACTGTGGGGG + Intergenic
961051832 3:123753087-123753109 GTGGCCAGTGGCTACCGTGCTGG - Intronic
968332495 3:197883673-197883695 CAGGCCAGTGCCCACCGTCCTGG - Intronic
968701045 4:2058624-2058646 GCGCCCCGTGGCCTCGGTGCAGG - Intergenic
968759218 4:2433434-2433456 GGGACCAGTGCCCTCGGTGTGGG + Intronic
970428107 4:15963804-15963826 GTGGCCTGTGGCCACGGTGATGG - Intronic
973996831 4:56467304-56467326 GCGTCCTGGTCCCACGGTGCGGG - Exonic
983656495 4:170090018-170090040 GCGGCCATAGGCCACGGCGCGGG - Intronic
984707716 4:182860058-182860080 GCAGCCAGTGCCTACTGTGTTGG + Intergenic
985445433 4:190018928-190018950 GGGCCCAGGGCCCACGGTCCTGG - Intergenic
985822645 5:2170480-2170502 GCGTCCCCTGGCCACGGTGCTGG + Intergenic
991035163 5:62121669-62121691 GTGGCCAGTCCCCACTGTGGTGG + Intergenic
996397471 5:123027477-123027499 GGTGCCCGTGCCCTCGGTGCTGG - Intronic
997641743 5:135452908-135452930 GCAGCCAGAGCCCGCAGTGCTGG - Intergenic
998140518 5:139697231-139697253 GGGGCCTGCGCCCACGGTGTCGG + Intergenic
998295640 5:140966754-140966776 GCGGCCAGTGGCTATGGAGCAGG + Exonic
1001023553 5:168204432-168204454 GCGACCATTGCCCATGATGCTGG - Exonic
1001155774 5:169271491-169271513 GTGGCCTGGGGCCACGGTGCTGG + Intronic
1003382304 6:5636394-5636416 GCTGCCAGGGCCCACAGTTCTGG - Intronic
1006071194 6:31498956-31498978 GCAGCCACTTCCCCCGGTGCTGG + Intronic
1007701836 6:43770317-43770339 CCGGCCAGGGCGCTCGGTGCTGG + Exonic
1018452242 6:163919800-163919822 TCAGCCAGTGCCCACGGGGCAGG - Intergenic
1019189633 6:170244236-170244258 CCCGCCTGTTCCCACGGTGCCGG + Intergenic
1019449974 7:1092463-1092485 GGGGCCGCAGCCCACGGTGCCGG - Exonic
1019526044 7:1480964-1480986 GCGGCCAGGGGCCAGGGAGCAGG + Intronic
1020006236 7:4785055-4785077 GAGGCCAGTGCCCTGGGTGGGGG - Intronic
1021572880 7:22083234-22083256 GGGGCCAGCGCCCCCAGTGCCGG + Intergenic
1022046805 7:26628123-26628145 GCGGCCACTGCCGAAGGGGCTGG + Intergenic
1022435132 7:30376211-30376233 GTGACCAGTGGCCACTGTGCTGG + Intronic
1024326251 7:48111445-48111467 GGGGCCAGTGCCCAGGTTGTGGG - Intergenic
1025615582 7:63113919-63113941 GCGGCTACTGCCCAAGGTACAGG - Intergenic
1026674502 7:72417490-72417512 GTGGCAAGTGCCCACGGTAGCGG - Intronic
1029126409 7:98297773-98297795 GCCGCCAGTGCCCCCGGTGCAGG - Intronic
1034413106 7:150951402-150951424 GCGGGGAGAGCCCACGGTGGAGG - Intronic
1044822318 8:96162566-96162588 GAGGCCAGTGTCCAGGGTGGAGG - Intergenic
1047778454 8:128092461-128092483 GGGGCCAATGGCCAGGGTGCCGG - Intergenic
1049218386 8:141417958-141417980 CCTGGCGGTGCCCACGGTGCTGG - Intronic
1049255717 8:141612546-141612568 GCGGGCTGTGCCCAGGGTTCAGG + Intergenic
1049738404 8:144222208-144222230 GCTGCCAGTGCCCAGGAGGCTGG + Intronic
1053433548 9:38059744-38059766 GAGGCCAGTGCCCTTTGTGCCGG - Intronic
1053441129 9:38117369-38117391 GCGGACAGTGCACACGGTCAAGG - Intergenic
1054254572 9:62800397-62800419 GGGCCCAGGGCCCACGGTCCTGG + Intergenic
1057304455 9:93904207-93904229 GAGGCCAGTGACCAGGGTGCAGG - Intergenic
1058923600 9:109640781-109640803 GCGGCCAGTGCACTCGGCTCCGG + Intronic
1059494845 9:114700882-114700904 GTGGCCAGTGGCTACTGTGCTGG + Intergenic
1062583557 9:137238640-137238662 GTGACCAGTGCCCACAGGGCTGG - Intergenic
1062584180 9:137241584-137241606 GCGGCCAGGGCGCGCGGGGCGGG + Intronic
1185460665 X:331572-331594 GCGGCCCGTGGGCACCGTGCTGG + Intergenic
1187859444 X:23667398-23667420 GCGGCCGGCGCCCACGTGGCGGG + Intronic
1190324863 X:49200119-49200141 GCGGGCTCTGTCCACGGTGCTGG + Intronic