ID: 1160523965

View in Genome Browser
Species Human (GRCh38)
Location 18:79524722-79524744
Sequence CCGGCCACCCAGGTTCCCGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160523965_1160523981 26 Left 1160523965 18:79524722-79524744 CCGACGGGAACCTGGGTGGCCGG No data
Right 1160523981 18:79524771-79524793 CCCGACGGGCTCTCCCACCGAGG No data
1160523965_1160523975 12 Left 1160523965 18:79524722-79524744 CCGACGGGAACCTGGGTGGCCGG No data
Right 1160523975 18:79524757-79524779 GGAACTTTCCGCCCCCCGACGGG No data
1160523965_1160523974 11 Left 1160523965 18:79524722-79524744 CCGACGGGAACCTGGGTGGCCGG No data
Right 1160523974 18:79524756-79524778 AGGAACTTTCCGCCCCCCGACGG No data
1160523965_1160523971 -9 Left 1160523965 18:79524722-79524744 CCGACGGGAACCTGGGTGGCCGG No data
Right 1160523971 18:79524736-79524758 GGTGGCCGGGGGACACACCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160523965 Original CRISPR CCGGCCACCCAGGTTCCCGT CGG (reversed) Intronic