ID: 1160528047

View in Genome Browser
Species Human (GRCh38)
Location 18:79548703-79548725
Sequence CTGCGGATGCTGATGGCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160528047_1160528058 25 Left 1160528047 18:79548703-79548725 CCGGCAGCCATCAGCATCCGCAG No data
Right 1160528058 18:79548751-79548773 CACAGCCCCGCATCCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160528047 Original CRISPR CTGCGGATGCTGATGGCTGC CGG (reversed) Intergenic
No off target data available for this crispr