ID: 1160528051 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:79548710-79548732 |
Sequence | GGGACCCCTGCGGATGCTGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1160528051_1160528058 | 18 | Left | 1160528051 | 18:79548710-79548732 | CCATCAGCATCCGCAGGGGTCCC | No data | ||
Right | 1160528058 | 18:79548751-79548773 | CACAGCCCCGCATCCACCCCAGG | No data | ||||
1160528051_1160528062 | 26 | Left | 1160528051 | 18:79548710-79548732 | CCATCAGCATCCGCAGGGGTCCC | No data | ||
Right | 1160528062 | 18:79548759-79548781 | CGCATCCACCCCAGGCTCACAGG | No data | ||||
1160528051_1160528063 | 27 | Left | 1160528051 | 18:79548710-79548732 | CCATCAGCATCCGCAGGGGTCCC | No data | ||
Right | 1160528063 | 18:79548760-79548782 | GCATCCACCCCAGGCTCACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1160528051 | Original CRISPR | GGGACCCCTGCGGATGCTGA TGG (reversed) | Intergenic | ||