ID: 1160528051

View in Genome Browser
Species Human (GRCh38)
Location 18:79548710-79548732
Sequence GGGACCCCTGCGGATGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160528051_1160528058 18 Left 1160528051 18:79548710-79548732 CCATCAGCATCCGCAGGGGTCCC No data
Right 1160528058 18:79548751-79548773 CACAGCCCCGCATCCACCCCAGG No data
1160528051_1160528062 26 Left 1160528051 18:79548710-79548732 CCATCAGCATCCGCAGGGGTCCC No data
Right 1160528062 18:79548759-79548781 CGCATCCACCCCAGGCTCACAGG No data
1160528051_1160528063 27 Left 1160528051 18:79548710-79548732 CCATCAGCATCCGCAGGGGTCCC No data
Right 1160528063 18:79548760-79548782 GCATCCACCCCAGGCTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160528051 Original CRISPR GGGACCCCTGCGGATGCTGA TGG (reversed) Intergenic