ID: 1160528053

View in Genome Browser
Species Human (GRCh38)
Location 18:79548730-79548752
Sequence TGAGCTGTGCGCGGAGACGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160528053_1160528063 7 Left 1160528053 18:79548730-79548752 CCCCCGTCTCCGCGCACAGCTCA No data
Right 1160528063 18:79548760-79548782 GCATCCACCCCAGGCTCACAGGG No data
1160528053_1160528058 -2 Left 1160528053 18:79548730-79548752 CCCCCGTCTCCGCGCACAGCTCA No data
Right 1160528058 18:79548751-79548773 CACAGCCCCGCATCCACCCCAGG No data
1160528053_1160528062 6 Left 1160528053 18:79548730-79548752 CCCCCGTCTCCGCGCACAGCTCA No data
Right 1160528062 18:79548759-79548781 CGCATCCACCCCAGGCTCACAGG No data
1160528053_1160528066 14 Left 1160528053 18:79548730-79548752 CCCCCGTCTCCGCGCACAGCTCA No data
Right 1160528066 18:79548767-79548789 CCCCAGGCTCACAGGGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160528053 Original CRISPR TGAGCTGTGCGCGGAGACGG GGG (reversed) Intergenic
No off target data available for this crispr