ID: 1160528056

View in Genome Browser
Species Human (GRCh38)
Location 18:79548733-79548755
Sequence CTGTGAGCTGTGCGCGGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160528056_1160528062 3 Left 1160528056 18:79548733-79548755 CCGTCTCCGCGCACAGCTCACAG No data
Right 1160528062 18:79548759-79548781 CGCATCCACCCCAGGCTCACAGG No data
1160528056_1160528058 -5 Left 1160528056 18:79548733-79548755 CCGTCTCCGCGCACAGCTCACAG No data
Right 1160528058 18:79548751-79548773 CACAGCCCCGCATCCACCCCAGG No data
1160528056_1160528063 4 Left 1160528056 18:79548733-79548755 CCGTCTCCGCGCACAGCTCACAG No data
Right 1160528063 18:79548760-79548782 GCATCCACCCCAGGCTCACAGGG No data
1160528056_1160528066 11 Left 1160528056 18:79548733-79548755 CCGTCTCCGCGCACAGCTCACAG No data
Right 1160528066 18:79548767-79548789 CCCCAGGCTCACAGGGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160528056 Original CRISPR CTGTGAGCTGTGCGCGGAGA CGG (reversed) Intergenic
No off target data available for this crispr