ID: 1160528057

View in Genome Browser
Species Human (GRCh38)
Location 18:79548739-79548761
Sequence GCGGGGCTGTGAGCTGTGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160528057_1160528071 25 Left 1160528057 18:79548739-79548761 CCGCGCACAGCTCACAGCCCCGC No data
Right 1160528071 18:79548787-79548809 CGGCTCCCTGCGTCCCGCCAAGG No data
1160528057_1160528063 -2 Left 1160528057 18:79548739-79548761 CCGCGCACAGCTCACAGCCCCGC No data
Right 1160528063 18:79548760-79548782 GCATCCACCCCAGGCTCACAGGG No data
1160528057_1160528066 5 Left 1160528057 18:79548739-79548761 CCGCGCACAGCTCACAGCCCCGC No data
Right 1160528066 18:79548767-79548789 CCCCAGGCTCACAGGGAGCCCGG No data
1160528057_1160528073 29 Left 1160528057 18:79548739-79548761 CCGCGCACAGCTCACAGCCCCGC No data
Right 1160528073 18:79548791-79548813 TCCCTGCGTCCCGCCAAGGGCGG No data
1160528057_1160528062 -3 Left 1160528057 18:79548739-79548761 CCGCGCACAGCTCACAGCCCCGC No data
Right 1160528062 18:79548759-79548781 CGCATCCACCCCAGGCTCACAGG No data
1160528057_1160528072 26 Left 1160528057 18:79548739-79548761 CCGCGCACAGCTCACAGCCCCGC No data
Right 1160528072 18:79548788-79548810 GGCTCCCTGCGTCCCGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160528057 Original CRISPR GCGGGGCTGTGAGCTGTGCG CGG (reversed) Intergenic