ID: 1160528058

View in Genome Browser
Species Human (GRCh38)
Location 18:79548751-79548773
Sequence CACAGCCCCGCATCCACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160528047_1160528058 25 Left 1160528047 18:79548703-79548725 CCGGCAGCCATCAGCATCCGCAG No data
Right 1160528058 18:79548751-79548773 CACAGCCCCGCATCCACCCCAGG No data
1160528053_1160528058 -2 Left 1160528053 18:79548730-79548752 CCCCCGTCTCCGCGCACAGCTCA No data
Right 1160528058 18:79548751-79548773 CACAGCCCCGCATCCACCCCAGG No data
1160528055_1160528058 -4 Left 1160528055 18:79548732-79548754 CCCGTCTCCGCGCACAGCTCACA No data
Right 1160528058 18:79548751-79548773 CACAGCCCCGCATCCACCCCAGG No data
1160528056_1160528058 -5 Left 1160528056 18:79548733-79548755 CCGTCTCCGCGCACAGCTCACAG No data
Right 1160528058 18:79548751-79548773 CACAGCCCCGCATCCACCCCAGG No data
1160528054_1160528058 -3 Left 1160528054 18:79548731-79548753 CCCCGTCTCCGCGCACAGCTCAC No data
Right 1160528058 18:79548751-79548773 CACAGCCCCGCATCCACCCCAGG No data
1160528052_1160528058 8 Left 1160528052 18:79548720-79548742 CCGCAGGGGTCCCCCGTCTCCGC No data
Right 1160528058 18:79548751-79548773 CACAGCCCCGCATCCACCCCAGG No data
1160528051_1160528058 18 Left 1160528051 18:79548710-79548732 CCATCAGCATCCGCAGGGGTCCC No data
Right 1160528058 18:79548751-79548773 CACAGCCCCGCATCCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160528058 Original CRISPR CACAGCCCCGCATCCACCCC AGG Intergenic
No off target data available for this crispr