ID: 1160528062

View in Genome Browser
Species Human (GRCh38)
Location 18:79548759-79548781
Sequence CGCATCCACCCCAGGCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160528052_1160528062 16 Left 1160528052 18:79548720-79548742 CCGCAGGGGTCCCCCGTCTCCGC No data
Right 1160528062 18:79548759-79548781 CGCATCCACCCCAGGCTCACAGG No data
1160528055_1160528062 4 Left 1160528055 18:79548732-79548754 CCCGTCTCCGCGCACAGCTCACA No data
Right 1160528062 18:79548759-79548781 CGCATCCACCCCAGGCTCACAGG No data
1160528057_1160528062 -3 Left 1160528057 18:79548739-79548761 CCGCGCACAGCTCACAGCCCCGC No data
Right 1160528062 18:79548759-79548781 CGCATCCACCCCAGGCTCACAGG No data
1160528053_1160528062 6 Left 1160528053 18:79548730-79548752 CCCCCGTCTCCGCGCACAGCTCA No data
Right 1160528062 18:79548759-79548781 CGCATCCACCCCAGGCTCACAGG No data
1160528054_1160528062 5 Left 1160528054 18:79548731-79548753 CCCCGTCTCCGCGCACAGCTCAC No data
Right 1160528062 18:79548759-79548781 CGCATCCACCCCAGGCTCACAGG No data
1160528051_1160528062 26 Left 1160528051 18:79548710-79548732 CCATCAGCATCCGCAGGGGTCCC No data
Right 1160528062 18:79548759-79548781 CGCATCCACCCCAGGCTCACAGG No data
1160528056_1160528062 3 Left 1160528056 18:79548733-79548755 CCGTCTCCGCGCACAGCTCACAG No data
Right 1160528062 18:79548759-79548781 CGCATCCACCCCAGGCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160528062 Original CRISPR CGCATCCACCCCAGGCTCAC AGG Intergenic
No off target data available for this crispr