ID: 1160528066

View in Genome Browser
Species Human (GRCh38)
Location 18:79548767-79548789
Sequence CCCCAGGCTCACAGGGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160528057_1160528066 5 Left 1160528057 18:79548739-79548761 CCGCGCACAGCTCACAGCCCCGC No data
Right 1160528066 18:79548767-79548789 CCCCAGGCTCACAGGGAGCCCGG No data
1160528056_1160528066 11 Left 1160528056 18:79548733-79548755 CCGTCTCCGCGCACAGCTCACAG No data
Right 1160528066 18:79548767-79548789 CCCCAGGCTCACAGGGAGCCCGG No data
1160528052_1160528066 24 Left 1160528052 18:79548720-79548742 CCGCAGGGGTCCCCCGTCTCCGC No data
Right 1160528066 18:79548767-79548789 CCCCAGGCTCACAGGGAGCCCGG No data
1160528054_1160528066 13 Left 1160528054 18:79548731-79548753 CCCCGTCTCCGCGCACAGCTCAC No data
Right 1160528066 18:79548767-79548789 CCCCAGGCTCACAGGGAGCCCGG No data
1160528055_1160528066 12 Left 1160528055 18:79548732-79548754 CCCGTCTCCGCGCACAGCTCACA No data
Right 1160528066 18:79548767-79548789 CCCCAGGCTCACAGGGAGCCCGG No data
1160528053_1160528066 14 Left 1160528053 18:79548730-79548752 CCCCCGTCTCCGCGCACAGCTCA No data
Right 1160528066 18:79548767-79548789 CCCCAGGCTCACAGGGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160528066 Original CRISPR CCCCAGGCTCACAGGGAGCC CGG Intergenic
No off target data available for this crispr