ID: 1160528068

View in Genome Browser
Species Human (GRCh38)
Location 18:79548769-79548791
Sequence AGCCGGGCTCCCTGTGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160528068_1160528076 2 Left 1160528068 18:79548769-79548791 CCAGGCTCACAGGGAGCCCGGCT No data
Right 1160528076 18:79548794-79548816 CTGCGTCCCGCCAAGGGCGGCGG No data
1160528068_1160528078 4 Left 1160528068 18:79548769-79548791 CCAGGCTCACAGGGAGCCCGGCT No data
Right 1160528078 18:79548796-79548818 GCGTCCCGCCAAGGGCGGCGGGG No data
1160528068_1160528071 -5 Left 1160528068 18:79548769-79548791 CCAGGCTCACAGGGAGCCCGGCT No data
Right 1160528071 18:79548787-79548809 CGGCTCCCTGCGTCCCGCCAAGG No data
1160528068_1160528082 14 Left 1160528068 18:79548769-79548791 CCAGGCTCACAGGGAGCCCGGCT No data
Right 1160528082 18:79548806-79548828 AAGGGCGGCGGGGTTTTGTTTGG No data
1160528068_1160528077 3 Left 1160528068 18:79548769-79548791 CCAGGCTCACAGGGAGCCCGGCT No data
Right 1160528077 18:79548795-79548817 TGCGTCCCGCCAAGGGCGGCGGG No data
1160528068_1160528073 -1 Left 1160528068 18:79548769-79548791 CCAGGCTCACAGGGAGCCCGGCT No data
Right 1160528073 18:79548791-79548813 TCCCTGCGTCCCGCCAAGGGCGG No data
1160528068_1160528084 23 Left 1160528068 18:79548769-79548791 CCAGGCTCACAGGGAGCCCGGCT No data
Right 1160528084 18:79548815-79548837 GGGGTTTTGTTTGGCAGGAAAGG No data
1160528068_1160528072 -4 Left 1160528068 18:79548769-79548791 CCAGGCTCACAGGGAGCCCGGCT No data
Right 1160528072 18:79548788-79548810 GGCTCCCTGCGTCCCGCCAAGGG No data
1160528068_1160528083 18 Left 1160528068 18:79548769-79548791 CCAGGCTCACAGGGAGCCCGGCT No data
Right 1160528083 18:79548810-79548832 GCGGCGGGGTTTTGTTTGGCAGG No data
1160528068_1160528085 28 Left 1160528068 18:79548769-79548791 CCAGGCTCACAGGGAGCCCGGCT No data
Right 1160528085 18:79548820-79548842 TTTGTTTGGCAGGAAAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160528068 Original CRISPR AGCCGGGCTCCCTGTGAGCC TGG (reversed) Intergenic