ID: 1160528071

View in Genome Browser
Species Human (GRCh38)
Location 18:79548787-79548809
Sequence CGGCTCCCTGCGTCCCGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160528065_1160528071 -3 Left 1160528065 18:79548767-79548789 CCCCAGGCTCACAGGGAGCCCGG No data
Right 1160528071 18:79548787-79548809 CGGCTCCCTGCGTCCCGCCAAGG No data
1160528067_1160528071 -4 Left 1160528067 18:79548768-79548790 CCCAGGCTCACAGGGAGCCCGGC No data
Right 1160528071 18:79548787-79548809 CGGCTCCCTGCGTCCCGCCAAGG No data
1160528061_1160528071 6 Left 1160528061 18:79548758-79548780 CCGCATCCACCCCAGGCTCACAG No data
Right 1160528071 18:79548787-79548809 CGGCTCCCTGCGTCCCGCCAAGG No data
1160528060_1160528071 7 Left 1160528060 18:79548757-79548779 CCCGCATCCACCCCAGGCTCACA No data
Right 1160528071 18:79548787-79548809 CGGCTCCCTGCGTCCCGCCAAGG No data
1160528057_1160528071 25 Left 1160528057 18:79548739-79548761 CCGCGCACAGCTCACAGCCCCGC No data
Right 1160528071 18:79548787-79548809 CGGCTCCCTGCGTCCCGCCAAGG No data
1160528059_1160528071 8 Left 1160528059 18:79548756-79548778 CCCCGCATCCACCCCAGGCTCAC No data
Right 1160528071 18:79548787-79548809 CGGCTCCCTGCGTCCCGCCAAGG No data
1160528068_1160528071 -5 Left 1160528068 18:79548769-79548791 CCAGGCTCACAGGGAGCCCGGCT No data
Right 1160528071 18:79548787-79548809 CGGCTCCCTGCGTCCCGCCAAGG No data
1160528064_1160528071 0 Left 1160528064 18:79548764-79548786 CCACCCCAGGCTCACAGGGAGCC No data
Right 1160528071 18:79548787-79548809 CGGCTCCCTGCGTCCCGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160528071 Original CRISPR CGGCTCCCTGCGTCCCGCCA AGG Intergenic