ID: 1160533298

View in Genome Browser
Species Human (GRCh38)
Location 18:79577723-79577745
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160533298_1160533307 29 Left 1160533298 18:79577723-79577745 CCCAGCCTTCCTCTCACTGGGTG No data
Right 1160533307 18:79577775-79577797 AGTGTCCAGCTCCCCTGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160533298 Original CRISPR CACCCAGTGAGAGGAAGGCT GGG (reversed) Intergenic
No off target data available for this crispr