ID: 1160533303

View in Genome Browser
Species Human (GRCh38)
Location 18:79577732-79577754
Sequence AGCCACTGCCACCCAGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160533303_1160533307 20 Left 1160533303 18:79577732-79577754 CCTCTCACTGGGTGGCAGTGGCT No data
Right 1160533307 18:79577775-79577797 AGTGTCCAGCTCCCCTGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160533303 Original CRISPR AGCCACTGCCACCCAGTGAG AGG (reversed) Intergenic
No off target data available for this crispr